Previously reported site was confirmed with EMSA, both with w-t and mutant (does not bind) protein.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TTATTGAGAATAATGTCAGTTT |
|
not specified | not specified | ||
| CTAATGATTATTTTGTTATTTG |
|
not specified | not specified |