Curation Information

Publication
Virulence regulator EspR of Mycobacterium tuberculosis is a nucleoid-associated protein.;Blasco B, Chen JM, Hartkoorn R, Sala C, Uplekar S, Rougemont J, Pojer F, Cole ST;PLoS pathogens 2012; 8(3):e1002621 [22479184]
TF
EspR [P9WJB7, view regulon]
Reported TF sp.
Mycobacterium tuberculosis H37Rv
Reported site sp.
Mycobacterium tuberculosis H37Rv
Created by
Dinara Sagitova
Curation notes
-
External databases
NCBI GEO ( GSE35149) http://www.ncbi.nlm.nih.gov/geo/query/acc.cgi?acc= GSE35149.

Experimental Process

ChIP-Seq results from two independent experiments identified 165 enriched loci harboring 582 EspR binding peaks. Of these loci, 45% were intergenic and 55% were intragenic. EspR consensus sequence derived from ChIP-Seq peaks was identified using the MEME suite. ChIP-qPCR on 11 selected sites confirmed the peaks obtained from ChIP-Seq analysis. EMSA using ca. 100 bp DNA fragments of the top five binding sites confirmed that EspR bound to these sequences. Direct autorepression at the espR promoter was confirmed by EMSA and DNase I footprinting. EspR-mediated regulation of genes related to the top 10 EspR binding peaks obtained in ChIP-Seq was verified by performing qRT-PCR.

ChIP assay conditions
Mtb H37Rv cultures (50 ml) grown to OD600 0.4–0.6 were treated with formaldehyde (final concentration 1%) for 10 min at 37°C. Cross-linking was quenched by addition of glycine to a final concentration of 125 mM.
ChIP notes
Harvested cells were washed twice with Tris-buffered saline (20 mM Tris-HCl pH 7.5, 150 mM NaCl), re-suspended in 600 µl Immunoprecipitation (IP) buffer (50 mM Hepes-KOH pH 7.5, 150 mM NaCl, 1 mM EDTA, 1% Triton X-100, 0.1% sodium deoxycholate, 0.1% SDS, mini-protease inhibitor cocktail (Roche)) and sonicated to shear DNA to an average size of 100–500 bp. Insoluble cellular debris was removed by centrifugation and the supernatant used as input sample in IP experiments. 300 µl of input was incubated with either no antibody (mock-IP) or 20 µl of serum containing rat anti-EspR polyclonal antibodies (kindly generated by Ida Rosenkrands) and then with 50 µl of Dynabeads sheep anti-rat IgG (Dynal Biotech) pre-saturated with 0.1 mg/ml salmon sperm DNA and 1 mg/ml Bovine Serum Albumin (BSA) in IP buffer. Washing and crosslink reversal of protein-DNA complexes, as well as purification of the resulting DNA was carried out as previously described.

Transcription Factor Binding Sites


CCAGCAAAC
CCAGCAAAC
CCAGCAAAC
CCAGCAAAC
CCAGCAAAC
CCAGCAAAT
CCAGCAAAT
CCAGCAAAT
CCAGCAAAT
CCAGCAAAT
CCAGCAAAT
CCGGCAAAC
CCGGCAAAC
CCGGCAAAC
GCAGCAAAC
GCAGCAAAC
GCAGCAAAC
TCAGCAAAC
TCAGCAAAC
CCGGCAAAC
CCGGCAAAC
CCGGCAAAC
CCGGCAAAC
CCGGCAAAC
GCAGCAAAC
GCAGCAAAC
TCAGCAAAC
TCAGCAAAC
GCAGCAAAC
GCAGCAAAC
TCAGCAAAT
TCAGCAAAT
ACAGCAAAC
ACAGCAAAC
CCGGCAAAT
ACAGCAAAC
TCAGCAAAT
CTAGCAAAC
CCAGCAAAG
CCAGCAAAG
CCAGCAAAG
CCAGCAAAG
ACAGCAAAC
ACAGCAAAC
ACAGCAAAC
TCAGCAAAT
TCAGCAAAT
TCAGCAAAT
TCAGCAAAT
GCAGCAAAT
TCAGCAAAT
CCAGCAAAG
CCAGCAAAG
CCAGCAAAG
CTAGCAAAT
CTAGCAAAT
CTAGCAAAT
ACAGCAAAT
ACAGCAAAT
ACAGCAAAT
ACAGCAAAT
ACAGCAAAT
ACAGCAAAT
GCGGCAAAC
GCGGCAAAC
TCGGCAAAC
TCGGCAAAC
TCGGCAAAC
TCGGCAAAC
GCGGCAAAC
GCGGCAAAC
GCGGCAAAC
GCGGCAAAC
GCGGCAAAC
GCGGCAAAC
CTGGCAAAC
GCAGCAAAG
GTAGCAAAC
GTAGCAAAC
CTGGCAAAC
CTGGCAAAC
TTAGCAAAC
CTGGCAAAC
CTGGCAAAC
CCGGCAAAG
TCGGCAAAT
TCGGCAAAT
TCGGCAAAT
CCGGCAAAG
CCGGCAAAG
GTAGCAAAC
GTAGCAAAC
TCAGCAAAG
CTGGCAAAC
CTGGCAAAC
CTGGCAAAC
CTGGCAAAC
CCAGCAAAA
CCAGCAAAA
CCAGCAAAA
CCAGCAAAA
ATAGCAAAC
ATAGCAAAC
GTAGCAAAT
GTAGCAAAT
CCAGCAAAA
ATAGCAAAC
ATAGCAAAC
CTGGCAAAT
CTGGCAAAT
CTGGCAAAT
CTGGCAAAT
ACAGCAAAG
CTGGCAAAT
CTGGCAAAT
CTGGCAAAT
ACGGCAAAT
CTAGCAAAG
ACAGCAAAG
CTAGCAAAG
GTAGCAAAT
ATAGCAAAT
TCGGCAAAG
TCGGCAAAG
TCGGCAAAG
TCGGCAAAG
GCGGCAAAG
GTGGCAAAC
GTGGCAAAC
GTGGCAAAC
GCGGCAAAG
GCGGCAAAG
TTGGCAAAC
TTGGCAAAC
GTGGCAAAC
GCAGCAAAA
TTGGCAAAT
TCAGCAAAA
GCAGCAAAA
GCAGCAAAA
GTGGCAAAT
GTGGCAAAT
GTGGCAAAT
TTGGCAAAT
CTGGCAAAG
CTGGCAAAG
CTGGCAAAG
ACGGCAAAG
ACGGCAAAG
ATGGCAAAC
ATGGCAAAC
TCAGCAAAA
GTAGCAAAG
GTAGCAAAG
GTGGCAAAT
GTGGCAAAT
ACGGCAAAG
CGAGCAAAC
CGAGCAAAC
CGAGCAAAC
CGAGCAAAC
CGAGCAAAC
CGAGCAAAC
CGAGCAAAT
CGAGCAAAT
CGAGCAAAT
CGAGCAAAT
CGAGCAAAT
CCAGCAACC
CCAGCAACC
CCAGCAACC
CCAGCAACC
TTGGCAAAG
CCAGCAATC
GCGGCAAAA
CCAGCAACC
GGAGCAAAC
CGGGCAAAC
CGGGCAAAC
CCAGCAATT
CCAGCAATT
CCAGCAATT
CCAGCAATT
GCCGCAAAC
CCAGCAACT
ATGGCAAAG
ATGGCAAAG
ATGGCAAAG
CCAGCAACT
CCAGCAACT
CCAGCAACT
CCAGCAACT
GGAGCAAAC
GTAGCAAAA
GTAGCAAAA
CTGGCAAAA
TGAGCAAAT
CGAGCAAAG
CGAGCAAAG
CCCGCAAAG
CTCGCAAAC
CTCGCAAAC
CGGGCAAAT
CTCGCAAAC
TCCGCAAAT
GGAGCAAAT
ACCGCAAAC
CTCGCAAAC
CTCGCAAAT
GCAGCAACC
CCGGCAATC
CCGGCAACC
GCAGCAATC
GCAGCAATC
CCGGCAACC
TCAGCAATC
CCGGCAACC
CCAGCAACG
CCAGCAACG
GCAGCAACT
CCAGCAACG
CCGGCAACT
CCGGCAACT
TTGGCAAAA
TTGGCAAAA
ACAGCAATC
ACAGCAATC
CCGGCAACT
TCAGCAACT
ACAGCAACC
CCAGCAACG
CCAGCAACG
CCAGCAACG
CTAGCAACC
CTAGCAACC
GGGGCAAAC
GCAGCAATT
GCAGCAACT
ATGGCAAAA
ATGGCAAAA
TCCGCAAAG
TCCGCAAAG
CCAGCGAAC
CCAGCGAAC
GTCGCAAAC
GTCGCAAAC
CGGGCAAAG
GCCGCAAAG
GCCGCAAAG
TGGGCAAAT
CAAGCAAAT
GCGGCAATC
TCGGCAACC
CCAGCGAAT
GCGGCAATC
GCGGCAATC
GCGGCAATC
GTCGCAAAT
CCCGCAAAA
ACCGCAAAG
GTAGCAATC
TTAGCAACC
GCAGCAATG
GCAGCAATG
CCGGCAACG
GCAGCAATG
GCAGCAATG
TCAGCAACG
CAGGCAAAC
GAAGCAAAT
GAAGCAAAT
ACAGCAATG
ACAGCAATG
TGGGCAAAG
CAGGCAAAT
TCAGCGAAT
GCCGCAAAA
TCAGCGAAT
GGAGCAAAA
GGAGCAAAA
GTCGCAAAG
GTCGCAAAG
GCGGCAATG
TTGGCAACC
GCGGCAACG
GCGGCAACG
CTCGCAAAA
TCGGCGAAC
TCGGCGAAC
CTGGCAATG
GTGGCAATT
GTGGCAATT
TCAGCAACA
TCAGCAACA
GCAGCAATA
CGCGCAAAT
CAGGCAAAG
TCAGCGAAG
GCAGCTAAC
GCAGCTAAC
GCAGCTAAC
GCAGCTAAC
CCGGCGAAG
GCGGCGAAT
GCGGCGAAT
AAGGCAAAT
CCCGCAATC
CGAGCAACC
CGAGCAACC
ACAGCAACA
CTGGCGAAT
GCAGCTAAT
TTGGCAATG
TTGGCAATG
GCGGCAATA
TGCGCAAAT
TGCGCAAAT
TTGGCAATG
GTGGCAACG
TGCGCAAAT
GCTGCAAAC
GCTGCAAAC
GAGGCAAAG
GAGGCAAAG
TCGGCTAAC
GGAGCAATC
ATGGCAACG
GTGGCGAAC
AAGGCAAAG
ACGGCTAAC
ACGGCTAAC
GCCGCAATT
CCGGCGAAA
TCCGCAACT
TCAGCTAAG
TCCGCAACT
TCCGCAACT
TTGGCGAAT
TCGGCTAAT
GTAGCGAAG
ACCGCAACC
TTAGCGAAG
ATGGCGAAC
TCCGCAACT
TCCGCAACT
CCCGCAACG
CCCGCAACG
CCCGCAACG
CCCGCGAAC
AGCGCAAAG
CGAGCGAAT
TCGGCGAAA
ATGGCAACA
AGGGCAATC
AGGGCAATT
ATTGCAAAT
AACGCAAAC
AACGCAAAC
CTGGCGAAA
CGAGCAACA
CACGCAAAG
CGGGCGAAT
AGCGCAAAA
AGGGCAATG
ATTGCAAAG
CCAGCTATC
ATCGCAACG
CGTGCAAAT
GGAGCTAAC
TCGGCGACC
CCCGCGAAA
GAAGCAATG
ACCGCTAAC
GCGGCGATC
TCGGCGACC
TCAGCGACG
CCGGCGATG
TCAGCTATC
CTGGCGACC
AAGGCAATT
GCAGCTACC
CAGGCGAAT
CAGGCGAAT
CAGGCGAAT
AGTGCAAAC
TGCGCAACC
GCCGCTAAG
ACCGCGAAA
CATGCAAAC
CCTGCAATG
GCGGCTACC
TCAGCGATA
CCGGCGATA
TTAGCGACG
ATAGCGATG
ATAGCTACC
ATAGCTACC
TCGGCGACA
TCGGCGACA
ATCGCGAAA
TCCGCGATC
CGAGCGACG
CGGGCGATG
TGGGCGACG
ACTGCGAAA
ACCGCGACA
GTGGGAAAT
CCAGCAAAC
CCAGCAAAC
CCAGCAAAC
CCAGCAAAC
CCAGCAAAC
CCAGCAAAT
CCAGCAAAT
CCAGCAAAT
CCAGCAAAT
CCAGCAAAT
CCAGCAAAT
CCGGCAAAC
CCGGCAAAC
CCGGCAAAC
GCAGCAAAC
GCAGCAAAC
GCAGCAAAC
TCAGCAAAC
TCAGCAAAC
CCGGCAAAC
CCGGCAAAC
CCGGCAAAC
CCGGCAAAC
CCGGCAAAC
GCAGCAAAC
GCAGCAAAC
TCAGCAAAC
TCAGCAAAC
GCAGCAAAC
GCAGCAAAC
TCAGCAAAT
TCAGCAAAT
ACAGCAAAC
ACAGCAAAC
CCGGCAAAT
ACAGCAAAC
TCAGCAAAT
CTAGCAAAC
CCAGCAAAG
CCAGCAAAG
CCAGCAAAG
CCAGCAAAG
ACAGCAAAC
ACAGCAAAC
ACAGCAAAC
TCAGCAAAT
TCAGCAAAT
TCAGCAAAT
TCAGCAAAT
GCAGCAAAT
TCAGCAAAT
CCAGCAAAG
CCAGCAAAG
CCAGCAAAG
CTAGCAAAT
CTAGCAAAT
CTAGCAAAT
ACAGCAAAT
ACAGCAAAT
ACAGCAAAT
ACAGCAAAT
ACAGCAAAT
ACAGCAAAT
GCGGCAAAC
GCGGCAAAC
TCGGCAAAC
TCGGCAAAC
TCGGCAAAC
TCGGCAAAC
GCGGCAAAC
GCGGCAAAC
GCGGCAAAC
GCGGCAAAC
GCGGCAAAC
GCGGCAAAC
CTGGCAAAC
GCAGCAAAG
GTAGCAAAC
GTAGCAAAC
CTGGCAAAC
CTGGCAAAC
TTAGCAAAC
CTGGCAAAC
CTGGCAAAC
CCGGCAAAG
TCGGCAAAT
TCGGCAAAT
TCGGCAAAT
CCGGCAAAG
CCGGCAAAG
GTAGCAAAC
GTAGCAAAC
TCAGCAAAG
CTGGCAAAC
CTGGCAAAC
CTGGCAAAC
CTGGCAAAC
CCAGCAAAA
CCAGCAAAA
CCAGCAAAA
CCAGCAAAA
ATAGCAAAC
ATAGCAAAC
GTAGCAAAT
GTAGCAAAT
CCAGCAAAA
ATAGCAAAC
ATAGCAAAC
CTGGCAAAT
CTGGCAAAT
CTGGCAAAT
CTGGCAAAT
ACAGCAAAG
CTGGCAAAT
CTGGCAAAT
CTGGCAAAT
ACGGCAAAT
CTAGCAAAG
ACAGCAAAG
CTAGCAAAG
GTAGCAAAT
ATAGCAAAT
TCGGCAAAG
TCGGCAAAG
TCGGCAAAG
TCGGCAAAG
GCGGCAAAG
GTGGCAAAC
GTGGCAAAC
GTGGCAAAC
GCGGCAAAG
GCGGCAAAG
TTGGCAAAC
TTGGCAAAC
GTGGCAAAC
GCAGCAAAA
TTGGCAAAT
TCAGCAAAA
GCAGCAAAA
GCAGCAAAA
GTGGCAAAT
GTGGCAAAT
GTGGCAAAT
TTGGCAAAT
CTGGCAAAG
CTGGCAAAG
CTGGCAAAG
ACGGCAAAG
ACGGCAAAG
ATGGCAAAC
ATGGCAAAC
TCAGCAAAA
GTAGCAAAG
GTAGCAAAG
GTGGCAAAT
GTGGCAAAT
ACGGCAAAG
CGAGCAAAC
CGAGCAAAC
CGAGCAAAC
CGAGCAAAC
CGAGCAAAC
CGAGCAAAC
CGAGCAAAT
CGAGCAAAT
CGAGCAAAT
CGAGCAAAT
CGAGCAAAT
CCAGCAACC
CCAGCAACC
CCAGCAACC
CCAGCAACC
TTGGCAAAG
CCAGCAATC
GCGGCAAAA
CCAGCAACC
GGAGCAAAC
CGGGCAAAC
CGGGCAAAC
CCAGCAATT
CCAGCAATT
CCAGCAATT
CCAGCAATT
GCCGCAAAC
CCAGCAACT
ATGGCAAAG
ATGGCAAAG
ATGGCAAAG
CCAGCAACT
CCAGCAACT
CCAGCAACT
CCAGCAACT
GGAGCAAAC
GTAGCAAAA
GTAGCAAAA
CTGGCAAAA
TGAGCAAAT
CGAGCAAAG
CGAGCAAAG
CCCGCAAAG
CTCGCAAAC
CTCGCAAAC
CGGGCAAAT
CTCGCAAAC
TCCGCAAAT
GGAGCAAAT
ACCGCAAAC
CTCGCAAAC
CTCGCAAAT
GCAGCAACC
CCGGCAATC
CCGGCAACC
GCAGCAATC
GCAGCAATC
CCGGCAACC
TCAGCAATC
CCGGCAACC
CCAGCAACG
CCAGCAACG
GCAGCAACT
CCAGCAACG
CCGGCAACT
CCGGCAACT
TTGGCAAAA
TTGGCAAAA
ACAGCAATC
ACAGCAATC
CCGGCAACT
TCAGCAACT
ACAGCAACC
CCAGCAACG
CCAGCAACG
CCAGCAACG
CTAGCAACC
CTAGCAACC
GGGGCAAAC
GCAGCAATT
GCAGCAACT
ATGGCAAAA
ATGGCAAAA
TCCGCAAAG
TCCGCAAAG
CCAGCGAAC
CCAGCGAAC
GTCGCAAAC
GTCGCAAAC
CGGGCAAAG
GCCGCAAAG
GCCGCAAAG
TGGGCAAAT
CAAGCAAAT
GCGGCAATC
TCGGCAACC
CCAGCGAAT
GCGGCAATC
GCGGCAATC
GCGGCAATC
GTCGCAAAT
CCCGCAAAA
ACCGCAAAG
GTAGCAATC
TTAGCAACC
GCAGCAATG
GCAGCAATG
CCGGCAACG
GCAGCAATG
GCAGCAATG
TCAGCAACG
CAGGCAAAC
GAAGCAAAT
GAAGCAAAT
ACAGCAATG
ACAGCAATG
TGGGCAAAG
CAGGCAAAT
TCAGCGAAT
GCCGCAAAA
TCAGCGAAT
GGAGCAAAA
GGAGCAAAA
GTCGCAAAG
GTCGCAAAG
GCGGCAATG
TTGGCAACC
GCGGCAACG
GCGGCAACG
CTCGCAAAA
TCGGCGAAC
TCGGCGAAC
CTGGCAATG
GTGGCAATT
GTGGCAATT
TCAGCAACA
TCAGCAACA
GCAGCAATA
CGCGCAAAT
CAGGCAAAG
TCAGCGAAG
GCAGCTAAC
GCAGCTAAC
GCAGCTAAC
GCAGCTAAC
CCGGCGAAG
GCGGCGAAT
GCGGCGAAT
AAGGCAAAT
CCCGCAATC
CGAGCAACC
CGAGCAACC
ACAGCAACA
CTGGCGAAT
GCAGCTAAT
TTGGCAATG
TTGGCAATG
GCGGCAATA
TGCGCAAAT
TGCGCAAAT
TTGGCAATG
GTGGCAACG
TGCGCAAAT
GCTGCAAAC
GCTGCAAAC
GAGGCAAAG
GAGGCAAAG
TCGGCTAAC
GGAGCAATC
ATGGCAACG
GTGGCGAAC
AAGGCAAAG
ACGGCTAAC
ACGGCTAAC
GCCGCAATT
CCGGCGAAA
TCCGCAACT
TCAGCTAAG
TCCGCAACT
TCCGCAACT
TTGGCGAAT
TCGGCTAAT
GTAGCGAAG
ACCGCAACC
TTAGCGAAG
ATGGCGAAC
TCCGCAACT
TCCGCAACT
CCCGCAACG
CCCGCAACG
CCCGCAACG
CCCGCGAAC
AGCGCAAAG
CGAGCGAAT
TCGGCGAAA
ATGGCAACA
AGGGCAATC
AGGGCAATT
ATTGCAAAT
AACGCAAAC
AACGCAAAC
CTGGCGAAA
CGAGCAACA
CACGCAAAG
CGGGCGAAT
AGCGCAAAA
AGGGCAATG
ATTGCAAAG
CCAGCTATC
ATCGCAACG
CGTGCAAAT
GGAGCTAAC
TCGGCGACC
CCCGCGAAA
GAAGCAATG
ACCGCTAAC
GCGGCGATC
TCGGCGACC
TCAGCGACG
CCGGCGATG
TCAGCTATC
CTGGCGACC
AAGGCAATT
GCAGCTACC
CAGGCGAAT
CAGGCGAAT
CAGGCGAAT
AGTGCAAAC
TGCGCAACC
GCCGCTAAG
ACCGCGAAA
CATGCAAAC
CCTGCAATG
GCGGCTACC
TCAGCGATA
CCGGCGATA
TTAGCGACG
ATAGCGATG
ATAGCTACC
ATAGCTACC
TCGGCGACA
TCGGCGACA
ATCGCGAAA
TCCGCGATC
CGAGCGACG
CGGGCGATG
TGGGCGACG
ACTGCGAAA
ACCGCGACA
GTGGGAAAT

Quantitative data format: Enrichment factor

CCAGCAAAC 1.55
CCAGCAAAC 4.42
CCAGCAAAC 1.73
CCAGCAAAC 1.76
CCAGCAAAC 1.52
CCAGCAAAT 1.68
CCAGCAAAT 1.71
CCAGCAAAT 1.59
CCAGCAAAT 1.71
CCAGCAAAT 2.03
CCAGCAAAT 2.04
CCGGCAAAC 1.55
CCGGCAAAC 1.56
CCGGCAAAC 1.56
GCAGCAAAC 2.69
GCAGCAAAC 1.72
GCAGCAAAC 1.74
TCAGCAAAC 1.62
TCAGCAAAC 1.62
CCGGCAAAC 2.04
CCGGCAAAC 2.0
CCGGCAAAC 4.49
CCGGCAAAC 4.77
CCGGCAAAC 2.43
GCAGCAAAC 1.5
GCAGCAAAC 1.52
TCAGCAAAC 2.43
TCAGCAAAC 2.57
GCAGCAAAC 2.46
GCAGCAAAC 2.42
TCAGCAAAT 1.88
TCAGCAAAT 2.21
ACAGCAAAC 3.64
ACAGCAAAC 4.07
CCGGCAAAT 3.06
ACAGCAAAC 1.91
TCAGCAAAT 9.51
CTAGCAAAC 2.6
CCAGCAAAG 2.14
CCAGCAAAG 2.16
CCAGCAAAG 2.17
CCAGCAAAG 1.69
ACAGCAAAC 1.69
ACAGCAAAC 1.65
ACAGCAAAC 1.6
TCAGCAAAT 1.68
TCAGCAAAT 1.78
TCAGCAAAT 1.96
TCAGCAAAT 1.89
GCAGCAAAT 2.73
TCAGCAAAT 2.34
CCAGCAAAG 1.63
CCAGCAAAG 1.7
CCAGCAAAG 1.64
CTAGCAAAT 1.68
CTAGCAAAT 1.73
CTAGCAAAT 1.75
ACAGCAAAT 2.6
ACAGCAAAT 2.79
ACAGCAAAT 5.13
ACAGCAAAT 5.06
ACAGCAAAT 1.61
ACAGCAAAT 1.57
GCGGCAAAC 1.56
GCGGCAAAC 2.29
TCGGCAAAC 2.08
TCGGCAAAC 2.02
TCGGCAAAC 2.33
TCGGCAAAC 2.04
GCGGCAAAC 2.25
GCGGCAAAC 2.35
GCGGCAAAC 1.96
GCGGCAAAC 1.87
GCGGCAAAC 1.77
GCGGCAAAC 1.69
CTGGCAAAC 2.25
GCAGCAAAG 2.08
GTAGCAAAC 2.11
GTAGCAAAC 2.1
CTGGCAAAC 1.72
CTGGCAAAC 2.26
TTAGCAAAC 2.6
CTGGCAAAC 2.08
CTGGCAAAC 2.09
CCGGCAAAG 1.62
TCGGCAAAT 1.56
TCGGCAAAT 1.58
TCGGCAAAT 1.6
CCGGCAAAG 2.05
CCGGCAAAG 3.55
GTAGCAAAC 2.11
GTAGCAAAC 2.11
TCAGCAAAG 4.08
CTGGCAAAC 1.78
CTGGCAAAC 1.77
CTGGCAAAC 2.19
CTGGCAAAC 4.66
CCAGCAAAA 1.93
CCAGCAAAA 1.9
CCAGCAAAA 1.91
CCAGCAAAA 1.91
ATAGCAAAC 1.99
ATAGCAAAC 2.06
GTAGCAAAT 2.53
GTAGCAAAT 2.63
CCAGCAAAA 2.44
ATAGCAAAC 1.64
ATAGCAAAC 1.65
CTGGCAAAT 1.94
CTGGCAAAT 6.77
CTGGCAAAT 6.58
CTGGCAAAT 2.49
ACAGCAAAG 6.89
CTGGCAAAT 7.54
CTGGCAAAT 7.0
CTGGCAAAT 6.35
ACGGCAAAT 1.67
CTAGCAAAG 2.23
ACAGCAAAG 2.11
CTAGCAAAG 2.29
GTAGCAAAT 2.98
ATAGCAAAT 3.28
TCGGCAAAG 1.82
TCGGCAAAG 1.72
TCGGCAAAG 4.14
TCGGCAAAG 4.16
GCGGCAAAG 2.73
GTGGCAAAC 3.33
GTGGCAAAC 3.5
GTGGCAAAC 1.65
GCGGCAAAG 2.34
GCGGCAAAG 2.39
TTGGCAAAC 3.33
TTGGCAAAC 3.2
GTGGCAAAC 3.23
GCAGCAAAA 3.31
TTGGCAAAT 2.18
TCAGCAAAA 2.68
GCAGCAAAA 2.61
GCAGCAAAA 2.59
GTGGCAAAT 1.68
GTGGCAAAT 1.65
GTGGCAAAT 1.61
TTGGCAAAT 1.53
CTGGCAAAG 1.61
CTGGCAAAG 1.64
CTGGCAAAG 1.62
ACGGCAAAG 3.04
ACGGCAAAG 3.04
ATGGCAAAC 1.86
ATGGCAAAC 1.91
TCAGCAAAA 2.18
GTAGCAAAG 2.61
GTAGCAAAG 2.6
GTGGCAAAT 3.24
GTGGCAAAT 3.29
ACGGCAAAG 1.99
CGAGCAAAC 1.72
CGAGCAAAC 1.71
CGAGCAAAC 3.7
CGAGCAAAC 3.63
CGAGCAAAC 1.58
CGAGCAAAC 1.63
CGAGCAAAT 3.19
CGAGCAAAT 3.19
CGAGCAAAT 2.92
CGAGCAAAT 1.5
CGAGCAAAT 1.53
CCAGCAACC 2.61
CCAGCAACC 2.7
CCAGCAACC 2.01
CCAGCAACC 2.02
TTGGCAAAG 3.34
CCAGCAATC 2.28
GCGGCAAAA 2.32
CCAGCAACC 2.3
GGAGCAAAC 2.63
CGGGCAAAC 1.82
CGGGCAAAC 1.74
CCAGCAATT 2.0
CCAGCAATT 2.07
CCAGCAATT 2.14
CCAGCAATT 2.18
GCCGCAAAC 2.14
CCAGCAACT 1.94
ATGGCAAAG 1.92
ATGGCAAAG 1.91
ATGGCAAAG 1.63
CCAGCAACT 1.61
CCAGCAACT 2.6
CCAGCAACT 2.59
CCAGCAACT 2.59
GGAGCAAAC 2.27
GTAGCAAAA 2.08
GTAGCAAAA 2.11
CTGGCAAAA 2.35
TGAGCAAAT 2.17
CGAGCAAAG 1.76
CGAGCAAAG 1.83
CCCGCAAAG 1.79
CTCGCAAAC 1.92
CTCGCAAAC 1.87
CGGGCAAAT 3.14
CTCGCAAAC 6.78
TCCGCAAAT 2.68
GGAGCAAAT 2.79
ACCGCAAAC 1.97
CTCGCAAAC 1.94
CTCGCAAAT 2.64
GCAGCAACC 2.13
CCGGCAATC 4.53
CCGGCAACC 1.89
GCAGCAATC 3.18
GCAGCAATC 2.61
CCGGCAACC 2.13
TCAGCAATC 2.45
CCGGCAACC 1.98
CCAGCAACG 1.9
CCAGCAACG 1.96
GCAGCAACT 1.99
CCAGCAACG 2.12
CCGGCAACT 1.64
CCGGCAACT 1.58
TTGGCAAAA 2.22
TTGGCAAAA 1.75
ACAGCAATC 1.77
ACAGCAATC 1.71
CCGGCAACT 3.05
TCAGCAACT 2.05
ACAGCAACC 4.15
CCAGCAACG 1.59
CCAGCAACG 1.59
CCAGCAACG 1.59
CTAGCAACC 2.15
CTAGCAACC 2.24
GGGGCAAAC 3.12
GCAGCAATT 2.15
GCAGCAACT 2.5
ATGGCAAAA 1.6
ATGGCAAAA 1.6
TCCGCAAAG 2.29
TCCGCAAAG 2.29
CCAGCGAAC 1.92
CCAGCGAAC 1.92
GTCGCAAAC 2.14
GTCGCAAAC 2.11
CGGGCAAAG 3.23
GCCGCAAAG 2.79
GCCGCAAAG 2.75
TGGGCAAAT 2.9
CAAGCAAAT 1.66
GCGGCAATC 1.61
TCGGCAACC 2.4
CCAGCGAAT 2.65
GCGGCAATC 1.68
GCGGCAATC 1.68
GCGGCAATC 1.7
GTCGCAAAT 1.64
CCCGCAAAA 1.61
ACCGCAAAG 1.52
GTAGCAATC 2.01
TTAGCAACC 2.29
GCAGCAATG 1.93
GCAGCAATG 1.94
CCGGCAACG 2.08
GCAGCAATG 1.54
GCAGCAATG 1.51
TCAGCAACG 1.88
CAGGCAAAC 1.99
GAAGCAAAT 1.85
GAAGCAAAT 1.83
ACAGCAATG 1.62
ACAGCAATG 1.56
TGGGCAAAG 2.0
CAGGCAAAT 2.27
TCAGCGAAT 1.54
GCCGCAAAA 1.95
TCAGCGAAT 1.75
GGAGCAAAA 1.72
GGAGCAAAA 1.76
GTCGCAAAG 2.12
GTCGCAAAG 2.1
GCGGCAATG 1.51
TTGGCAACC 1.5
GCGGCAACG 2.59
GCGGCAACG 2.58
CTCGCAAAA 2.31
TCGGCGAAC 1.78
TCGGCGAAC 1.8
CTGGCAATG 3.44
GTGGCAATT 1.85
GTGGCAATT 1.87
TCAGCAACA 2.05
TCAGCAACA 2.02
GCAGCAATA 2.41
CGCGCAAAT 1.79
CAGGCAAAG 1.53
TCAGCGAAG 1.97
GCAGCTAAC 2.77
GCAGCTAAC 1.75
GCAGCTAAC 1.76
GCAGCTAAC 1.75
CCGGCGAAG 1.64
GCGGCGAAT 2.05
GCGGCGAAT 2.09
AAGGCAAAT 2.19
CCCGCAATC 1.97
CGAGCAACC 2.0
CGAGCAACC 1.89
ACAGCAACA 1.65
CTGGCGAAT 2.09
GCAGCTAAT 2.12
TTGGCAATG 2.25
TTGGCAATG 2.19
GCGGCAATA 1.5
TGCGCAAAT 2.18
TGCGCAAAT 1.81
TTGGCAATG 1.69
GTGGCAACG 6.88
TGCGCAAAT 2.13
GCTGCAAAC 1.68
GCTGCAAAC 1.68
GAGGCAAAG 1.55
GAGGCAAAG 1.56
TCGGCTAAC 1.77
GGAGCAATC 1.67
ATGGCAACG 3.42
GTGGCGAAC 2.25
AAGGCAAAG 1.77
ACGGCTAAC 1.72
ACGGCTAAC 1.73
GCCGCAATT 1.77
CCGGCGAAA 2.04
TCCGCAACT 3.46
TCAGCTAAG 1.79
TCCGCAACT 1.77
TCCGCAACT 1.78
TTGGCGAAT 2.72
TCGGCTAAT 2.52
GTAGCGAAG 1.64
ACCGCAACC 2.14
TTAGCGAAG 3.35
ATGGCGAAC 1.75
TCCGCAACT 1.85
TCCGCAACT 1.86
CCCGCAACG 2.01
CCCGCAACG 1.98
CCCGCAACG 2.0
CCCGCGAAC 2.02
AGCGCAAAG 2.62
CGAGCGAAT 2.02
TCGGCGAAA 2.89
ATGGCAACA 2.79
AGGGCAATC 1.93
AGGGCAATT 2.2
ATTGCAAAT 2.11
AACGCAAAC 1.89
AACGCAAAC 2.01
CTGGCGAAA 1.91
CGAGCAACA 2.35
CACGCAAAG 1.96
CGGGCGAAT 2.11
AGCGCAAAA 1.56
AGGGCAATG 2.59
ATTGCAAAG 1.84
CCAGCTATC 5.01
ATCGCAACG 1.7
CGTGCAAAT 1.6
GGAGCTAAC 4.97
TCGGCGACC 1.83
CCCGCGAAA 2.75
GAAGCAATG 1.89
ACCGCTAAC 1.92
GCGGCGATC 1.84
TCGGCGACC 2.01
TCAGCGACG 2.01
CCGGCGATG 1.93
TCAGCTATC 1.89
CTGGCGACC 1.73
AAGGCAATT 1.61
GCAGCTACC 1.75
CAGGCGAAT 1.76
CAGGCGAAT 1.74
CAGGCGAAT 1.74
AGTGCAAAC 1.94
TGCGCAACC 1.86
GCCGCTAAG 2.52
ACCGCGAAA 1.66
CATGCAAAC 2.48
CCTGCAATG 2.0
GCGGCTACC 2.15
TCAGCGATA 2.19
CCGGCGATA 5.0
TTAGCGACG 1.98
ATAGCGATG 2.53
ATAGCTACC 2.14
ATAGCTACC 2.34
TCGGCGACA 1.7
TCGGCGACA 1.6
ATCGCGAAA 1.56
TCCGCGATC 1.95
CGAGCGACG 2.08
CGGGCGATG 1.88
TGGGCGACG 2.08
ACTGCGAAA 2.12
ACCGCGACA 1.56
GTGGGAAAT 1.91
GGAATGCGGGTCAAATATGTCTCCACCGAGGAATTCACCAACGACTTCATTAACTCGCTCCGCGATGACCGCAAGGTCGCATTCAAACGCAGCTACCGCGAC None
CTCGCTCCGCGATGACCGCAAGGTCGCATTCAAACGCAGCTACCGCGACGTAGACGTGCTGTTGGTCGACGACATCCAATTCATTGAAGGCAAAGAGGGTAT None
AATTCATTGAAGGCAAAGAGGGTATTCAAGAGGAGTTCTTCCACACCTTCAACACCTTGCACAATGCCAACAAGCAAATCGTCATCTCATCTGACCGCCCAC None
CGGGGGTAATTGCCAGCCTTGGACGTGCGCGCCAAGTGGCGCTCGCAAACAAGATCAGACCCAGCGCGGCAACTCCGGTCAACACCCGCCCGGGCGTATCTG None
TCACGACTCCCCCGGCTCCGCAACCAGCGATTCCCGAGGTGCGAGGCGCCCATGCTGTTTGCTGCATGTATTCCTTAGACCCTCTCACCACTGCAGACAAAG None
GCTGTTTGCTGCATGTATTCCTTAGACCCTCTCACCACTGCAGACAAAGTTATCCACAGACGCTATCAACAGTGGGGATGAATCACATGCGTGTGATTGAGT None
TGCAGACAAAGTTATCCACAGACGCTATCAACAGTGGGGATGAATCACATGCGTGTGATTGAGTGACCAAAAGGTTGCTGGCACAGTAACGACCCGACCAGA None
CCGGTCCGGGTACCCCGGAGCGCGCGGGCGCGTCGGTGAGTATCGTGCACGCGTGTGCGGCAGCACACACCCCTTTGCTGGGGGTCTGCCTTGGGCACCAAG None
GTGCGGCAGCACACACCCCTTTGCTGGGGGTCTGCCTTGGGCACCAAGCCATCGGCGTTGCGTTCGGCGCCACCGTGGACCGTGCGCCCGAGCTATTGCACG None
CCATGTCGGAGCAAGCCGGGTCTTCGGTAGCTGTCATCCAGGAGCGCCAGGCTTTGCTGGCAAGGCAACACGACGCCGTGGCCGAAGCCGACCGTGAGTTGG None
GCTGCTGCTCGAGGATCCGGGTTTGCTGGCCGATGACCTACAGGTGCCGGGAGGCACATCCGCGGCAATACCATCAGCGTCGTCGACGCCAAGCCTGCCCAA None
GGTCGAGGAACTCGACGAGTATGCCGAGCATGCGCCGGTATTGGCCCGGCTTTGGCGCAACGTCAAGACGGAGGCAAAGGATTACCAGCGCGAGGACCTGAA None
CGGCTTTGGCGCAACGTCAAGACGGAGGCAAAGGATTACCAGCGCGAGGACCTGAACCCTGAGTTCTTCGCGGCGTGTTCTCGGCATCTGCATGGACGTAGC None
CTTCGCGGCGTGTTCTCGGCATCTGCATGGACGTAGCAGACTGTGGTTGTTCCGCTACCAGGGCACGCCAATTGCCTTCTTTTTGAACGTTTGGGGTGCGGA None
CGCGGCGGCCGTGGTTGACGCTCTCGCCGGCAAGGGCGCCAGCGCGATCGTTCTGCGCGGTTTGCTCAAGGAGTCGATTTCTAACGCGCCGCATTTGCTGGA None
CTGCGCGGTTTGCTCAAGGAGTCGATTTCTAACGCGCCGCATTTGCTGGACGCAGAGGTCGGACATGCACTCCGCCGCGCCGTGCTCAGCGACGAAATCTCC None
GACTTTCTTTGGTATCCCTATTACGCCTCGTACGGCCTGCTCCTGCTTCCGTTCTTCACTCCCACCTTGAGCGCGTTGACCGCCCTAAGCGCGCTGATCCAT None
CTTCACTCCCACCTTGAGCGCGTTGACCGCCCTAAGCGCGCTGATCCATTTGCTGAACCTGCCCCCGGCTGGACTGCTTCCTATCGCCGCAGCGCTCGGTCC None
GTGGCTTGAGGATTCGGTGCGGGTCGCCAGTTAATCCGCCGTGTGCTCCGGATGAGCGCGACGGTAACCCTGGAATTGTGCTGTGTGCTGGCTGTGTCGTTG None
ACGGTAACCCTGGAATTGTGCTGTGTGCTGGCTGTGTCGTTGTGATGAGCCTGTCTAAGTGGTGCGTAACCGTTTGACGAGCCGCGGCCTCGCTGCAAACAT None
CTAAGTGGTGCGTAACCGTTTGACGAGCCGCGGCCTCGCTGCAAACATTGAAGCCCGCACGTCTGGGTTTGTATTTACACAACGAGGGCGCTCCCCGATCTG None
TATGGTGTTTCTAAGGCGGCCACCGACATGCTGGCGTATCAATATCACAAGTCTTACGGCATGCACACCGTCGTCGCTCGTATCTTCAATTGCACCGGGCCA None
TACGGCATGCACACCGTCGTCGCTCGTATCTTCAATTGCACCGGGCCACGCAAAGTCGGAGATGCACTTTCCGATTTCGTCCGCCGTTGTACATGGTTGGAG None
GGAGATGCACTTTCCGATTTCGTCCGCCGTTGTACATGGTTGGAGCACCATCCGGAACAAAGTGCCATCCGGGTGGGAAATCTTAAGACGAAACGGACTATC None
AAAGTGCCATCCGGGTGGGAAATCTTAAGACGAAACGGACTATCGTGGACGTCCGCGATCTCAATCGGGCGTTGATGCTGATGCTGGATAAAGGCGAGGCCG None
AACAAGAAATCTGTTTGACTCAGACGATTGCCGACATGTTCGATTATTGGCGTAGCAAATCCGAGTCCGCCCTGATGGTGTGACCGAATGTCTTTGTCCTGC None
TGTGTGGCAACGGTGGTAGCGCTGCGGATGCGCAACATTTTGCCGCGGAGCTAACGGGTCACCTGATCTTTGATCGGCCACCGCTTGGCGCCGAGGCACTCC None
TGACTACGACACCGTTTTTGCCAGGGCCCTCGAAGGATCTGCGCGTCCCGGCGACACGCTTTTTGCGATAAGTACCTCCGGCAATTCTATGAGTGTACTGCG None
AATTCTATGAGTGTACTGCGGGCCGCGAAAACCGCAAGGGAGTTGGGTGTGACGGTTGTTGCAATGACGGGCGAATCCGGCGGCCAGCTGGCAGAATTCGCA None
GCAACCAGGACCATCAGAATGATAGGCAGGTTCCAGCGTTCGGCGTTGGCAATATCGTGTTTGGTGTTTGCCGCCGCGGCCGCGGACAGCGCGCCCTGCCCG None
GTTCCAGCGTTCGGCGTTGGCAATATCGTGTTTGGTGTTTGCCGCCGCGGCCGCGGACAGCGCGCCCTGCCCGATGACATAGAGCCGCACTTTGCCGTTGGC None
CGTGTTTGGTGTTTGCCGCCGCGGCCGCGGACAGCGCGCCCTGCCCGATGACATAGAGCCGCACTTTGCCGTTGGCAGTTTGCCCGGACTGATCGCCTTTGA None
ACAGCGCGCCCTGCCCGATGACATAGAGCCGCACTTTGCCGTTGGCAGTTTGCCCGGACTGATCGCCTTTGACGCCTATTCGGTCGCGCAGCTTTTTGGCGA None
CGAGGCCGGCTAGCGCACCGCACACCAGATACGGCCACAGTGGCAAACCAGGGTTGGCCAGCAACAGAATGCTGCCAACGGTCGGAATCAACAGCACCAGTG None
CCAGCAACAGAATGCTGCCAACGGTCGGAATCAACAGCACCAGTGCGGAAAAGATGGTCCAGTTGCGCCCCCCGAACTTTGCGGTGGCAAATGTGTAAGGGA None
ACAGCACCAGTGCGGAAAAGATGGTCCAGTTGCGCCCCCCGAACTTTGCGGTGGCAAATGTGTAAGGGAAGCGCAGGCATGCCCCGACCAAGGTCGCGGTGG None
GGGGTACCACCGATGCTGATGCCGATGGGGATCGGGCCGAAGCCGCCGGTGCCAACCATGCTGATGGTTTGCTGAATGGGCGAATCGATGGCGATGACTTGA None
CGGTGCCAACCATGCTGATGGTTTGCTGAATGGGCGAATCGATGGCGATGACTTGATTGACATCGATCGTGATGGGGCCGATCATCTCGTTGACAAGCACCG None
CCCGTGTTGGTGCTGCCCGTGTTCCCGAGGCCGGTGTTGAAGCTGCCCGAGTTTGCGATGCCGAAGTTTGCGGTGCCGGTGTTTCCGATGCCCACGTTGCCG None
CCGATATGGTAGTTGCCCGAGTTGGCGAAGCCGACGCTGTAGTTGCCCAGGTTTGCCAAGCCAATGTTGTGGTTGCCCACGTTTGCGAAACCGACATTGAAG None
TGAAGATTCCGGTGTTCCCGATCCCGAAGTTAGAGCCCCCGAGGTTTGCCAAGCCGACATTGAGGTTGCCGAGGCCGGCCAAGTCGAGGATCGTCGTGCCGG None
CTGGTAGTCGCCCCGCCACAAGATGCCGTTGCTGTAGTTGCCGGAGATGAAAGCGCCGGTGCTGACGTCGCCCGTATTCGCGATGCCGGTGTTGTAGTTCCC None
CCGGTGTTGAAGTTACCGGGGTTGAAGCCGCCGGTGTTGCCGTCGCCCGAGTTGAACAAGCCCGTGCTGGTGCTGCCCGAGTTGCCGATGCCGAAGTTTCCG None
GCCGATATTGTTGCTGCCGGTGTTGGCAAAGCCGATATTGTTGCTGCCGGTGTTGGCAACGCCGATGTTGTAGCTGCCTAGGTTGGCAAAGCCCAGGTTGTC None
GCCACGCCGACGTCAAAGATCCCGGTGTTGCCGAAGCCGGCGTTATTGCTGCCCAGGTTTGCCAGCCCAAGGTTCAGAGTCATCGTGCCCATACCGTCGCGC None
CCGCGTGCAAGCCAATGAGGCCCTGATAATTTCCACTCCACAAGAACCCGTTGCTGTAGCTGCCGGAGATGAAGGCGCCGGTGTCAACATCGCCGGTGTTTC None
CGCCGGAGTTGAAGAAGCCGGTGTTGGTGCTGCCGGTGTTTCCAAGCCCGAAGTTTGCGGTGCCGGTGTTGCCGATGCCAACGTTTCCGTTGCCCGAGTTGA None
GTCGCCCGTGAGCCCAATGCCGATATTGTTGCTGCCGGTGTTCGCGAACCCGATATTGTTGCTGCCGGTGTTGGCGAAGCCCAGGTTGTCGTTGCCCAAGTT None
AAGCCCAGGTTGTCATCGCCGAAGTTTCCGAAGCCGATGTTGTAACTGCCCAGATTTGCCAAACCGATGTCGAATATTCCGGTGTTTGCGCCGCCGATGTTG None
GCCCAGATTTGCCAAACCGATGTCGAATATTCCGGTGTTTGCGCCGCCGATGTTGTTGCCACCGATATTGGCGCTGCCGAAGTTGGCGCTGCCGAGGTTTGC None
CGTTGCTGTAGTTTCCGGTGATGAAAGCCCCGGTGTCAACGTCGCCGGTGTTGGCGATGCCGGTGTTGTAGTTGCCAATGTTGAGGTAGCCGGTGTTGGTAT None
AGGCCGGTATTGGTGTTGCCGGTGTTTCCGATGCCAGTGTTGAAGCTGCCCGAGTTTGCGATGCCGAAGTTGCCGCTGCCGGAATTGAAGAATCCGATGTTG None
CGGTGTTCGCAAAGCCGATGTTGCCGCCGCCCGCGTTAGCGAAACCCAGATTGTCGTTGCCGACGTTGCCGAAGCCGATGTTGTAGCTGCCGAAGTTGCCGA None
AGCCGCAGTACCCGCGCCGTCGCGCAGCAGGCCGGCAATATTGGTTCCGATATTTGCCAACCCGGAGTTAACGGCGGGCGTCGAGAGGTCCGACGTGCCCAC None
GGGATTTCGGGAATGTCGACGCCGATGGCGAGGTCGATCAGACCCTGGTTGTCGCCCCGCCACAGAAGGCCGTTGCTGTGGTTGCCGGAGATGAAAGCGCCG None
TTGTCGCCCCGCCACAGAAGGCCGTTGCTGTGGTTGCCGGAGATGAAAGCGCCGGTGTTGATATTGCCGGTGTTCGCCATGCCGGTGTTGTAAGTCGCCGGT None
AGCGCCGGTGTTGATATTGCCGGTGTTCGCCATGCCGGTGTTGTAAGTCGCCGGTGTTGAAGTAGCCGGTGTTGTAGTTACCTGCATTGAAGCCACCGGTGT None
CGCCGGTGTTGAAGTAGCCGGTGTTGTAGTTACCTGCATTGAAGCCACCGGTGTTGACGCTGCCGGTGTTGACGCTGCCGGTGTTATAGCTGCCCGGGTTCA None
CCGATATTGTTGCTGCCGATATTCGCAAAACCGATATTGTTGTCACCCGTGTTCGCGAAGCCAAGATTATTGCTGCCGGTGTTCGCAAAGCCGATGTTGTAG None
GCTGCCGGTGTTCGCAAAGCCGATGTTGTAGCTGCCCGCGTGGGCGAAGCCCAGGTTGTCGCCGCCTAGATTGCCGAAGCCAATATTGTAGTCGCCCAGGTT None
TGTCGCCGCCTAGATTGCCGAAGCCAATATTGTAGTCGCCCAGGTTTGCCAAGCCCACATTGAAGATTCCGGCGTTTGCACCGCCGACATTGTTGCCGCCGA None
CATGCCCGGAATCGTCATCACGCTTCCGGGCATGACCATCACCTGATGTATCGGCATGCTGAATAGCTGCGCGTTTATCGGAATGGCGGGAATCTCGAGGGC None
GTCGCCCCGCCACAAGACGCCGTTGCTGTAGTTGCCGGCGATGAAGGCGCCGGTGTTGACGTTGCCGGTGTTGGCCACTCCAGTGTTGTAGTCGCCGGTGTT None
TTGTAGTCGCCGGTGTTGAAGTAGCCGGTGTTGTAGTTACCTGCGTTGAAGCTGCCGGTGTTGTAGTTGCCGGTGTTGAAGTTCCCGGTGTTGTAGCTGCCC None
AGTTTCCGGTGCCGCTGTTTCCGATGCCGAAATTGCCGGTGCCCGAGTTGAACAACCCGACGTTTCCGCTGCCGGAGTTGAACAGGCCGATGTTGTGGCTGC None
GGTGAGCCCGATGCCGACATTGTTGCTGCCCGTATTCCCAAAGCCGACATTGTTGCTGCCGGTGTTCGCAAAGCCGATGTTGTGGCCGCCCAGGTTGGCCAA None
AAAGCCGAGGTTGTAGCTGCCCAAATTGCCGAAGCCGACGTTGAACACGCCGACGTTTCCGTTGCCCACGTTGTTGGCGCCGACGTTTGCCAAGCCGAGATT None
GCACGACATCGGGATAAAGAACCCTGCGTGGGTGCGCTTCTGGGATGGTGTATCCCTGATCTTGGGCCCAGTCGTGCTGCGGCCGCTGGGTTTGCTGGCCGC None
GTGTATCCCTGATCTTGGGCCCAGTCGTGCTGCGGCCGCTGGGTTTGCTGGCCGCGATGGTCGCACTGGCGAAGCGCAAGATACGGATAGCGTTGTTGCTGT None
GCTGGCCGCGATGGTCGCACTGGCGAAGCGCAAGATACGGATAGCGTTGTTGCTGTTGGCCTGTTTACCGCTCAACGCGATCATGACGATCGCGGCCAAATC None
GCGCTGCCGCTGATGGCTGGCGGTGTGCCAGGGCAGCTGGTGGGTTGTCACGTCCACAATGGTGCCATCGTTGTCCACTGGAATTTGCTGTCAGGTGCCAAA None
GGCAGCTGGTGGGTTGTCACGTCCACAATGGTGCCATCGTTGTCCACTGGAATTTGCTGTCAGGTGCCAAATCGTGATCAGCGTTTGCCCGGTGGACGGGCC None
CCCGGACCGGTGTTTGCGATCCCGACGTTAAAGTCGCCGATGTTTGCGCCGCCGATGTTCGCGTTGCCAATGTTGCCGAAGCCGACGTTTGAATTGCCGAGG None
ACTGCCGAGGTTTGCACTGCCGAGGTTTGCACTGCCCACGTTGAATTGGCCGAGGTTTGCCAGGCCCGCGTTGAAGGTCGACCCGTTCGGGCCGCGGAGCAC None
GTTGATTGTGGCCGGACAGCCCGATACCGATGTTGTTGTTGCCGGTGTTGGCAAACCCGATGTTGTTGCTGCCGCTGTTGGCGAAGCCCAGGTTGAAATCGC None
ACCGATGTTGTTGTTGCCGGTGTTGGCAAACCCGATGTTGTTGCTGCCGCTGTTGGCGAAGCCCAGGTTGAAATCGCCGGCGTTGCCGAATCCGAAGTTGTA None
AACCCGATGTTGTTGCTGCCGCTGTTGGCGAAGCCCAGGTTGAAATCGCCGGCGTTGCCGAATCCGAAGTTGTAGCTGCCCAGGTTGCCTAGGCCGATGTTG None
TCCGAAGTTGTAGCTGCCCAGGTTGCCTAGGCCGATGTTGTAGTTACCCAGGTTCGCCGGGCCGATATTGTATGAGCCCCGGTTTCCGGAGAAGACGTTGAA None
AGAGTTGAACAGGCCGCTGTTGCCGCTGCCGGAGTTCCAGCCACCGGCAAAATTGAAGCCCTGCTGGTTGTCGCCGGACAGGCCGATACCGATGTTGTTGTT None
GCAAAATTGAAGCCCTGCTGGTTGTCGCCGGACAGGCCGATACCGATGTTGTTGTTGCCGGTGTTGGCAAACCCGATGTTGTTGTTGCCGGTGTTGGCGAAG None
CGCCGGACAGGCCGATACCGATGTTGTTGTTGCCGGTGTTGGCAAACCCGATGTTGTTGTTGCCGGTGTTGGCGAAGCCCAGGTTGAAGTCGCCGGCGTTGC None
TTGTTGCCGGTGTTGGCGAAGCCCAGGTTGAAGTCGCCGGCGTTGCCGAATCCGAAGTTGTAGCTGCCCAGGTTGCCTAGGCCGATGTTGTAGTTACCCAGG None
GTTGCCGAATCCGAAGTTGTAGCTGCCCAGGTTGCCTAGGCCGATGTTGTAGTTACCCAGGTTCGCCGGGCCGATGTTGTATGAGCCCTGGTTTCCGCCGAA None
TTGCCGCTGCCGGAGTTGCCGATACCCCAGTTGCCGGTGCCCGAGTTGCCGATGCCGACGTTGTTGGTGCCGGAGTTGAACAAGCCGATGTTCGCGGTGCCT None
AACAAGCCGATGTTCGCGGTGCCTGAGTTCCAGCCGCCAGCAAAATTGAAGCCCTGCTGGTTGTCGCCGGACAGCCCGATGCCGATGTTGTTGTTGCCGGTG None
CCTGCTGGTTGTCGCCGGACAGCCCGATGCCGATGTTGTTGTTGCCGGTGTTGGCAAATCCGATGTTGTTGTTGCCGGTGTTGGCAAAGCCTTGGTTGAAAT None
TGTTGGCAAATCCGATGTTGTTGTTGCCGGTGTTGGCAAAGCCTTGGTTGAAATCGCCGGCGTTGCCGAAGCCGATGTTGTAGTTACCCAGGTTCGCGAAAC None
AATCGCCGGCGTTGCCGAAGCCGATGTTGTAGTTACCCAGGTTCGCGAAACCGATGTTGTAGTTACCCAGGTTCGCCGGACCGATATTGTATGAGCCCTGGT None
GAAGAAGCCGGTGTTGGTGTCACCCGGGTTATAGCTGCCGGTATTGGTGTCACCCACGTTGAAGTTGCCGGTGTTGGTGTTACCGACGTTGAAGCCGCCGGT None
GGACAGCCCGATGCCGATGTTGTTGTTGCCGGTGTTGGCGAACCCGATGTTGTTGTTGCCGGTGTTGGCAAAGCCTTGGTTGAAGTCGCCCGCGTTCCCGAA None
GATGTTTCCACTGCCGATATTGAAGCTGCCGACGTTGCCGCTGCCCAAGATGTTTTGGCTGCCGAGGTTGCCGCTGCCAAGGATGTTGAAGTCACCGACGTT None
CGACGTTTCCGCTGCCGAGAATGTTGTAATTGCCGATGTTGGCGTTGCCGAGAATGTTCACGACGCCCCGGTTTGCCAGGCCGAGATTGAAGACCGGTGGGC None
GTTGAACAAACCCGATACGGTGTTGCCCGAGTTGATCACGCCCGATACCAGCACGCCCGCGTTTGCCAGGCCGGAGTTACCGATGGCCCCCGACGAAGAGTT None
ATGAAGGCGCCGGTGTTGACATTGCCGGAGTTTGCCAAGCCGGTGTTGTAGTTGCCGCTGTTCAGGTAGCCCGTGTTGTACTGGCCCATGTTGAAGCCGCCG None
CATTCAGCACGACCCACTGTCGCGCTAGCCGGGCGGAAATCCACCGTCCGGTGGCGTCGCTTCGACATGGCATACGGCCTTTGCTACCCGGTCACCGCTGGC None
TCGCTTCGACATGGCATACGGCCTTTGCTACCCGGTCACCGCTGGCTAGCATGAGTGCGACTGAGTGGAGCGGGGATGAGCAAGTTGCTGCCACGGGGCACA None
CATGAGTGCGACTGAGTGGAGCGGGGATGAGCAAGTTGCTGCCACGGGGCACAGTGACATTGCTGTTGGCCGACGTCGAGGGATCCACCTGGCTGTGGGAGA None
CAACTTGTCGTGAGCCGCTCCGGGTCGAGGGTGAGGTGAGCTACCGGGTGCCGTCGCTGTCACTGAGCGATGAAGCCGTTGAGATGTTTTGCTACCGGGCTC None
GCGATGAAGCCGTTGAGATGTTTTGCTACCGGGCTCAGCGAGTCCGGCCGGACTTTCGCCTCACCGACGACAACTCCGCCGCAGTGACCGAGATCTGCAAAC None
CGCCTCACCGACGACAACTCCGCCGCAGTGACCGAGATCTGCAAACGGCTGGACGGTTTGCCGCTGGCGATCGAGCTGGCGGCTGCGCGGCTGCGGTCGATG None
CCACCAGCGGAAAGATTAGCCGGGCGGCATGCGCAAAGCAGTACGGAGCAAATAAGTTGCAACGAGTAGCAACGTTCCCATGACAGACGGTTCGGTCACTGC None
ACGGGCGTATTCGTTGGGGTGTCGTCAACTGACTACGTCCGGCTTGTGTCAGCTAGCGCTCAGCAAAAGTCTACTATTTGGGATAACACCGGCGGTTCTTCG None
CGATCACCCCACCCCGACCGAACTAGCCCAGTATCTGATCACCCAAATAGACGGTCACGGCAGCTCCGCCGCCGCAGCGGCAAACCCGGCGGAGCGAATCGA None
TAGACGGTCACGGCAGCTCCGCCGCCGCAGCGGCAAACCCGGCGGAGCGAATCGATGCGCTCACCGATCTTTTTCTACAAGCTTGCGATGCGGGTCGGGATG None
GGCGTCGAATACGCGCGAGCGCATGAGCTCACCGGTTCGGAACAACGTATCGAAGAACGTCGCACTGCTGGCAGATGGTATCTCCGATGTGGTTGTAATTTG None
TACCGTCGAAAATTTACGCGAAGAACGAATCAACCGGTGGCGAACTGCTGCTGCAGAGGCGGCCTATTCTGTAGCCGAAGTACCCGGGGATCATTTCGGAAT None
GGATCATTTCGGAATGATGAGCACCTCGAGTGAGGCAATAGCTACCGAAATACATGATTGGATTTCTGGGCTCGTTCGAGGGCCTCATCGGTAGCTTTGCGA None
ATCGGCCCGTGCCACAGCTCGCCGTGACCAGGTGCCAGGATGTTGGTCTCTAGCAAAGCCAGCGCAGCCAGGCTGCGGATACTGTTCTGCTGGCTGTGGCTG None
GCGCCAGTTGTGCGACGGCCGCAGACGCATCGAAGTGGTAACCAGCCATCGCCGCCACGTCCAATGCCCACATTTGCTCGTATGCCGCCTCGACGTCCATGA None
GCAGACGCATCGAAGTGGTAACCAGCCATCGCCGCCACGTCCAATGCCCACATTTGCTCGTATGCCGCCTCGACGTCCATGAGCGCCGGAGCATTCTGCCCA None
ATGTTTTCCATGGCCTCAATCTGCGGCGGGATCTGCGCGACCATTTGTGGCATGAGGCGATCCATCTCGCGCAAGTCGCCCAAGAGGACGCCTATTTGCTCG None
GCGATCCATCTCGCGCAAGTCGCCCAAGAGGACGCCTATTTGCTCGCTGAGCTTGTCGATTCCGTCCAGTGCATCGAATATCGATCTGAACGACCAACAGAT None
TACCCTCTATTATGACCATCGCGAAACTGTCGGAATCGCCTTCCTTGAACACCATGCCGATACGTCCCATCGCCTCAAACGACGGTGCATCCTTGGGACTCA None
TGGCCGACAGCTTCCAGTGACGGGACAAATACGGTGACAACGACGCAAACTGCCAGCCAGCCAAGGATGATCGGTACCGCAAAGGCGTGGATCATCCTGGCG None
ACACCGACATGTCGCCGGCTGGGTATCCATTGCACACCTCGGTCCCTTTAGCGACGACGCCCTTGTTGTTGAAGAAGATTTTCATGTGATTGACCCAGGCAA None
GCCCTTGTTGTTGAAGAAGATTTTCATGTGATTGACCCAGGCAAACGTCAGCGGATCGCCATTGTAAAAGTGTTCGGAGTAGTCTCGGCGCTCCGCCGGTGA None
GTGCGCACGCTGGTCACCGACGAAGCCGCCGCCGCGCGCACGGAGGAGTTTGCCAGTACTGTGCTGGGCAAACAGGTCGTGCGTTGCTCCGACCGCTCCGGA None
TACTGTGCTGGGCAAACAGGTCGTGCGTTGCTCCGACCGCTCCGGATTCGTGGTCAATGCGCTCCTGGTGCCGTATTTGCTGTCGGCGATTCGGATGGTCGA None
TCAATGCGCTCCTGGTGCCGTATTTGCTGTCGGCGATTCGGATGGTCGAGGCCGGGTTTGCCACCGTCGAAGATGTCGACAAGGCCGTTGTTGCGGGGTTAT None
GATGTGAACGTCATCGGTATCACGCTCAGTCGCAATCAGTTCGAGTACAGCAAAGCGAAATTGGCGAAAATTCCCACCGAACGCAGCGTCCAGGTGCGGCTG None
AAATTCATCGGCGAAGAAATTTTTCCGGGCGGACAGTTACCGGCGCAGGAAGACATCTTCAAATTTGCGCAGGCGGCGGACTTTTCGGTGGAGAAGGTGCAA None
ACATCTTCAAATTTGCGCAGGCGGCGGACTTTTCGGTGGAGAAGGTGCAATTGCTGCAGCAGCATTACGCTCGGACGCTAAACATCTGGGCGGCGAATCTGG None
ACATGCACTATCTGACCGGATGTGAGCACTTCTTCCGCAAGGGCATCAGCAACGTGGGACAGTTCACACTGACCAAGTAGCCCATCGCCGCCCGAGCACCCC None
TCGGCTTCGTTGCCATGATGACGCTCAAGGTCGCGATCGGCCCGCAAAACGCATTTGTCCTGCGCCAAGGAATTAGGCGAGAATACGTGCTGGTCATTGTGG None
GAGGCCAACCGGCTCGGTGACATGGTCGCCGAGTTGATCGAGCTATCCCGGCTACAGGGCGCCGAGCGGCTACCCAATATGACCGACGTCGACGTCGATACG None
CTATCCCGGCTACAGGGCGCCGAGCGGCTACCCAATATGACCGACGTCGACGTCGATACGATTGTGTCGGAAGCGATTTCACGCCATAAGGTGGCGGCCGAC None
TTTCACGCCATAAGGTGGCGGCCGACAACGCCGACATCGAAGTCCGCACCGACGCGCCCAGCAATCTGCGGGTGCTGGGCGACCAAACTCTGCTGGTTACCG None
ACGCGCCCAGCAATCTGCGGGTGCTGGGCGACCAAACTCTGCTGGTTACCGCACTGGCAAACCTGGTTTCCAATGCGATTGCCTATTCGCCGCGCGGGTCGC None
GGCCGAGGCCGGAGACAAAAGTATCGCTAAGGTCACCGCGATCACGAGCATGGTGATCGCAGCAATGTTGCTAGTGATCTATCGCTCCGTAATTACCGCGGT None
ACGAGCATGGTGATCGCAGCAATGTTGCTAGTGATCTATCGCTCCGTAATTACCGCGGTTCTCGTCTTGATCATGGTCGGCATCGACCTCGGCGCAATCCGC None
CGCAATCCGCGGATTCATCGCCTTGCTCGCCGACCACAACATTTTCAGCCTTTCAACATTTGCGACCAACCTGCTCGTTCTCATGGCGATTGCGGCGAGCAC None
GATACCGTTCATCATCAGCATGCAGGGCGTGAATAGTAGCGAGCAAATGGAATTCATGAAGGACCGAATTGATGACATACTGGTGCAGGTGGCCGCGATGAA None
ATTTCAAGCGGGGGCTGAAGATGTTTTTGTCTCCGGACGGCAAGGCAGCCCGCTTTGTCATTGCTCTGGAGGGAGATCCCGCAACGCCCGAGGGCATCTCTC None
TCTCCGGACGGCAAGGCAGCCCGCTTTGTCATTGCTCTGGAGGGAGATCCCGCAACGCCCGAGGGCATCTCTCGGGTCGAGCCGATCAAGCGGGAGGCTAGA None
GTCATTGCTCTGGAGGGAGATCCCGCAACGCCCGAGGGCATCTCTCGGGTCGAGCCGATCAAGCGGGAGGCTAGAGAGGCCATAAAGGGAACTCCATTGCAG None
CGCCCGAGGGCATCTCTCGGGTCGAGCCGATCAAGCGGGAGGCTAGAGAGGCCATAAAGGGAACTCCATTGCAGGGCGCTGCGATCTATCTGGGTGGCACCG None
TCTGATCGGCAACGGCGTCACCGGGACGGCGGCAGCTCCCAACGGTGGCCCCGGCGGTTTGCTATTCGGTGACGGTGGGGCCGGCTATACCGGCGGTAACGG None
GGCAGCTCCCAACGGTGGCCCCGGCGGTTTGCTATTCGGTGACGGTGGGGCCGGCTATACCGGCGGTAACGGTGGGAGTGCCGGGTTAATCGGCAACGGGGG None
CGGTTTGCTATTCGGTGACGGTGGGGCCGGCTATACCGGCGGTAACGGTGGGAGTGCCGGGTTAATCGGCAACGGGGGTACCGGTGGCGCCGGCTTTGCCGG None
GGCTATACCGGCGGTAACGGTGGGAGTGCCGGGTTAATCGGCAACGGGGGTACCGGTGGCGCCGGCTTTGCCGGCGGAGTGGGCGGCATGGGCGGCACCGGC None
ACGGCGTACGCCGGACCCGGTCGCCGGGACGATACCGGGCTAGTGTTAGCTAGCGGTGGAAAAAGCCCGACACGAAATCGATCGAATTAAAGCCACCAGAAT None
CCAGCCCATCGGTAGTATTGCCGAAACCGGTGTTCAGGTTGCCCGCGTTAAAGCCGCCCGTGTTGATATTGCCAGAATTTGCGAAGCCGGTGTTCGTCAGGC None
ACCCGAGTTGAAGCTACCGGTGTTAATGATGCCGCCGTTGAAGTTGCCGGTGTTGAAATCGCCCGCGTTCCCTATGCCGGTATTGGCCTGACCTGAGTTGCC None
GTAGCTGCCGCTGTTCCCGAAGCCAACGTTGCCGTCGCCTACGTTTCCCAGACCGATATTTGCGTTGCCCGTGTTACCACCGCCGAAGTTTCCATTGCCACC None
ATATTTGCGTTGCCCGTGTTACCACCGCCGAAGTTTCCATTGCCACCGTTGCCAATCCCGACATTCCCATTGCCGGGGGTGGGCACGGCGGGGGAACTCATG None
GTTACCGAGGTTTCCATTACCCAGGTTGTAATCGCCGGTATTACCATTGCCGACATTGAGGTTGCCGATATTGCCGACACCCAAATTGATGTTTGGCAACGC None
ACGTCCGCGGCGATCTTCTCCCAGGGAGCCGGTATCGGGAAATAGCGCTCCAGGAAACTGACGACTCGTTCTGCGCGCTGCGCTGCGGGGACTTCAGGAAAG None
ACTGACGACTCGTTCTGCGCGCTGCGCTGCGGGGACTTCAGGAAAGCTACCGTCGTTGAGGCAGAAGAAATCGTATCCGCGGTGCTTCCGCAACTTAGGAAG None
TGAGGCAGAAGAAATCGTATCCGCGGTGCTTCCGCAACTTAGGAAGTAGCCGAAGACCCGCATAGCTGGTGGTGTCGACATAGAGGACTTTAGCCTTTTCCT None
GGCGGCGGGGTTGAATCCGTCGCGATGAAGATGCGACGTATCCACGGAGCAAACATGTTCACCGACCGCAGCGCGTATTTCAACTCGTCGATTTGGCGGATC None
ATGTCTATGTCGAACACGACGTCGCTGGCGTGCGGGGCAAACATCCCGTCAAGGGTCGGCCATTTGTACCCGTAGAGTTTGACATTTGTCGGCGTTATTTCG None
CGGATCGGTGTCGTGGGGCTCATGGTCGCCGCGATGGTCGTTGGAACCAGCCGGTCCGAATGGCCACAGCAAATCGTGTTGATCGGCGTCTACGCGGTCGCT None
CCGGTCCGAATGGCCACAGCAAATCGTGTTGATCGGCGTCTACGCGGTCGCTGCATTGTGGGCTCTGCTGTTAGCGTATTCGGCGTCCCGGCGATTCTTCGC None
GGCGACCCTGGACTTGCTCTCCCCGCTGGCGGCCGCAAAGAATAGTGTGTTTGCCAGTGCTACCGCCATTGCCGAGTCGACCGCGAAGTTCGCCATTACCGG None
GGCGGCCGCAAAGAATAGTGTGTTTGCCAGTGCTACCGCCATTGCCGAGTCGACCGCGAAGTTCGCCATTACCGGCCAGGTCAATGCCGTCAGTCCAGACTT None
CGAAGTTCGCCATTACCGGCCAGGTCAATGCCGTCAGTCCAGACTTGTCGGCGCCGTCTGCGGTAGCGGCCCGGTGCACCAGCAAGTACATCCGAGAACCCA None
CCATCAACCGGCGCAATTGTGAAACTCCAGCTGCCTTTGCTGCATCCATTTCGGCGGAAATTCAGCGCAGCGATGCAGAAATTCCCGGCAAACAGCGGCGGA None
AGTTTGTCGCGCTGCTGGGGCAAAGTGGAAGTGGTAAAAGCACTTTGCTGAACCTCATCAGTGGCATAGAAAAGCCCACCACAGGTGACGTCACAATTAATG None
CAACAACGGGTCGCTATTTCCAGAGCGTTGGCGCATAATCCCATGCTGGTGTTAGCCGATGAGCCGACCGGCAACCTGGACTCCGATACCGGGGATAAAGTC None
CGGACTGGGAAACCGAGCTATGCAGTTCATGGGCACCGACCCATTTGCGGAGTCAGCTTTTCGCTCGCCTTTATGGTCCAACCAAAATATCGCCGAGTTGGG None
CTGTGGGCGATCGCATTGCTCTGCAAGTGAAAGGTGCGCCTACCACAGTAACCCTGGTGGGATTGCTGACACCTGCAGATGAAGTTAGCAATCAAAAATTGT None
GTTTGGGTGTAACCCGAGAGCAGTTATTTTGGCTGATAATGACGGAATCCCTCGTTGCCGGGCTGATTGGTACGGGCTTGGGCCTCTTGATTGGAATTTGGC None
ATGTTCGCAATGTGTCCGTCTCCGCCGAAAGCTTGTTGAAGGGGCTGATCATCGGCATCTTTGCCGCCATGTTAGCCACACTGCCACCGGCTATAGAAGCGA None
TCATCGGCATCTTTGCCGCCATGTTAGCCACACTGCCACCGGCTATAGAAGCGATGCGCACCGTCCCTGCCAGCACATTGCGGCGCTCCTCCCTGGAAAGCA None
GTGGTTTGGTTTGGGTAGCTTTGGTGTATTGATGCTGTGGTTGCCGGGCAACAACCTGGTTGTGGCCTTTGTCGGTCTCTTTAGTGTGCTGATTGCCCTGGC None
TGATTGCCCTGGCGCTTATTGCCCCGCCGCTGACCCGGTTTGTAATGTTGCGCTTAGCTCCTGGCTTAGGACGGCTGCTCGGTCCAATAGGTCGAATGGCGC None
AAATTCAGTCGGCAGGCGTTGGGTTTGGCTGGTGCTAGCTCGGAGCCGTATGCGGTGTGGCTAGACGATTGGTATGCGCGTGAATCCAACAACAATTCGGTG None
GCCGTATGCGGTGTGGCTAGACGATTGGTATGCGCGTGAATCCAACAACAATTCGGTGCAATTGTTTGCTCGAACTCAGAACACGGTGTTGGATTTGACATT None
ATTCGGTGCAATTGTTTGCTCGAACTCAGAACACGGTGTTGGATTTGACATTGACGCAAACGCTGCCGCCTATCTTGCAAGGAAATGCTGGGTTAAGTGTGA None
GCTCTCGAATGGTCGTCGGGCAGTTGTGATATCGCTGCAAACCCTAGAGTACTTATTCGTCGTTGTGTCAACAGGTAGTTGCTGGGGTGTGTCGCTAGTCGC None
TGATATCGCTGCAAACCCTAGAGTACTTATTCGTCGTTGTGTCAACAGGTAGTTGCTGGGGTGTGTCGCTAGTCGCACGCAGATATCGCGTGGTCGATCAAT None
TACTTATTCGTCGTTGTGTCAACAGGTAGTTGCTGGGGTGTGTCGCTAGTCGCACGCAGATATCGCGTGGTCGATCAATGTCGCAAGGGCTCGGCGAGGTTG None
AGGTTGGCGGTCAGGCAAATAGGGGAGCTCCTCTCGCGCCTGTGCGGCATAGGCGGCTACCACATTCTTGGCCTTTCCTATGCCCGGTGAGCAACGCAGCAG None
GGCAGCCTCGATGGCGCCTTCGGCGATCGCTACCGGCGCCCCACTGTTCAGGGCATTTGCTAGGAATATCGCGGTGGGGATGGCGGCGTTGACATACCAAGC None
ATCGCTACCGGCGCCCCACTGTTCAGGGCATTTGCTAGGAATATCGCGGTGGGGATGGCGGCGTTGACATACCAAGCGGCGGTGTTGACTGCGCTGTTGATG None
GCATTTGCTAGGAATATCGCGGTGGGGATGGCGGCGTTGACATACCAAGCGGCGGTGTTGACTGCGCTGTTGATGATGTTTGCCACGAACGGGGTCGCGAGC None
GGATGGCGGCGTTGACATACCAAGCGGCGGTGTTGACTGCGCTGTTGATGATGTTTGCCACGAACGGGGTCGCGAGCAGGGCGTCGATGTCGGCAATGATTC None
ATTTTGATTTGAATTATGAGAATTTCTTATTTCCCAGTTATGGGGAGCGTGTGCTGGTTGTTAGCGAAGTACGCTAAAACTGCAGTTACTGCTCATAGCACT None
GGGAGCGTGTGCTGGTTGTTAGCGAAGTACGCTAAAACTGCAGTTACTGCTCATAGCACTGGTTTGCCACATACCCCGTATCGGGATACGTCATGATCGGTA None
TGCTCATAGCACTGGTTTGCCACATACCCCGTATCGGGATACGTCATGATCGGTATCCTGAGCGGAACATAAGTCGGTCACGTGACCTAGGTAACAGCGTCT None
TGCGACGGAGACACCAACACAAACGACACGGTTTCCTCTCCCTGATTTGCTGATATGTAGTTGCGATGTTAACTAGCGCACACCGCAACTGGGGCGGTTTTC None
GTCTTCCAGGGGAATGTTCGTACCGTTTCATGACGTCGACTGTGTCCAATAGCTTTACATTTCCCGTTTTTATTTGCTGATGATGTCTAACACCTAGACAAA None
GGGATCAGTTTAGGACGGTTGTGCCGATTTCGTGGATAGCTGACGAACAAACCCGTCACGGTGTGGACCAAATGTGGTATCGAATCAGACTCTTTGGCTGTG None
ATCGAATCAGACTCTTTGGCTGTGGCACCTAAAAAAGACTGTCAAGCTAAGTTCGCGGGGTTGGCTGAGCCAGAGGCTCAGCCGCTTCGTCACATGCTGTAT None
TCAGCGACGGCGCCCCGGTGGAGGTCGTCGAGTCTGGTCCAAGTCTTGTTGCGCGATTAGCTGCGCTGGCGTCACGAGTGGCGGTCCGGCCGGTGCTAGCGG None
TGGCGTCACGAGTGGCGGTCCGGCCGGTGCTAGCGGTCGGTAGCTATCTTCCGCATGCGCCCTGGCCGTGGGGTGTCATCGACCAGGCTGCCCGGGTTCTGC None
AGTGGGGGAGGAGCCGGCGGCTCTAGTCGCGATCTCGCCACTGCTGCAGCTAGCAAAGGAACACAAGCAGGCGCATCCCAACATCAAAACCGATGCGATGTT None
AGCAAAGGAACACAAGCAGGCGCATCCCAACATCAAAACCGATGCGATGTTCCCGGCAAGGGCGTTCGATGCGCTTGACGCATTGGTTGCTAGCGCAGCAGC None
GATGTTCCCGGCAAGGGCGTTCGATGCGCTTGACGCATTGGTTGCTAGCGCAGCAGCGAGGAACCAGGTAGACGGCGAACCCGAAGAGCTCTATGAGCCCTT None
TGCGGTCGCCTCGCAATGGGATGGTGGCTACGTGGCCAATTACACGATCACCCAATTCGGGCGCGACTTCGATGACCGATTGGCGGTTGCAATTCACTTTGC None
ATTCGGGCGCGACTTCGATGACCGATTGGCGGTTGCAATTCACTTTGCCTGAAAATGCCTCTATTTCGAACGCGTGCTGCGCTCAACTTGCCCAGTCGGGCA None
AATTCACTTTGCCTGAAAATGCCTCTATTTCGAACGCGTGCTGCGCTCAACTTGCCCAGTCGGGCACGCAGTACACTCTTGACGCCCGAGAGCTATAACGGC None
CGCGGACGCGGTCGGCCATCGTGACGACGAGATGCTGGCGGCATGTACGGCAACCGCTGGCTCGTCTTAGAGCCATTTGCTGAGGCGCATGCTTTGCGTCAT None
GCAACCGCTGGCTCGTCTTAGAGCCATTTGCTGAGGCGCATGCTTTGCGTCATGCAAAGTGCATATGCCGCCAGCGGGATGGTGTGCATTCTGTCCATGGGA None
GGTTGAAGGCGGCGTGCGCGGAAAGCGGTGTTGCGCTGGCTGAGGAAGTGTCCTGAGTTGTATACCGTCAGCGTTGCTGGGAGTAATCGACCCGGTGCCGCG None
GTTGCGCTGGCTGAGGAAGTGTCCTGAGTTGTATACCGTCAGCGTTGCTGGGAGTAATCGACCCGGTGCCGCGTGGCGCATGTTCGGCCATGTTCATTGCCC None
AGTTGTATACCGTCAGCGTTGCTGGGAGTAATCGACCCGGTGCCGCGTGGCGCATGTTCGGCCATGTTCATTGCCCGATTTGGCGCGATAGCGTGATTTATG None
CTCCGCATTGCCAATGACGGCAAAATTCAGCTGCCAAAGTCCGCAATACTGGGTTTGCTGGCCGTTGCCGTGTTTGCGCCGGAGAACAAGGGCGAGGTCATT None
ACGCCGAATGTCGGCAGCACCCAGACTGCGCCCTGTAAGTAATCCAGTATGGCTTTGCGACGGTTGAGCATGCTGGTTGCGGTCACCGAATAAGCATGCACC None
CTGCGCCCTGTAAGTAATCCAGTATGGCTTTGCGACGGTTGAGCATGCTGGTTGCGGTCACCGAATAAGCATGCACCCATCCGCGAGCACTAGGCGGAACTA None
TTGCGACGGTTGAGCATGCTGGTTGCGGTCACCGAATAAGCATGCACCCATCCGCGAGCACTAGGCGGAACTACGTAACACTTCGATGCGGCAGTAGAAGCA None
GTTCTTCATCACCGTCGGTTTGGTTGAGGCGGCATACTTCATCAACCTGGCGTTTATGGCGCTGTTCGTCTTCGCTACACCCGTCAAGTAATTCGACGGCAA None
TGGCGTTTATGGCGCTGTTCGTCTTCGCTACACCCGTCAAGTAATTCGACGGCAAATGGTTGCAATAGGTAGCAATGGGTGAAGTGAGCGCGATTGTCCTGG None
CGATTGTCCTGGCCGCCAGTCAGGCGGCAGAGGAAGGCGGCGAGTCCAGCAACTTCCTCATTCCCAACGGCACGTTTTTCGTTGTGCTGGCCATCTTCCTGG None
GGACATGCTTAGCGGTAGGGCGCGCGCCAAGGCGGCAGCAATCGCATCACTGCGCTGCGCGTCACTATTAACCCACCCGGACTTCACTTCCACGACCCCGAA None
TACCCGAGCGCCCCCGACTACATCTCCTCCAATATCAATGGCGGCAAAGAACAACTGTGTATCGGAACCGTCACTGATGGCGTCGAGATCTAAGGTACACTC None
ATGATTCTCCAATCTGTTAGGTATCCGGCAATTAACACGAGATTTGCTGCCCCTGTATCGAGCAGCGCAGACGTTGGGGCTGCGCCCGGAGAATTGCTGCCG None
GCGGGGCATACTGTTCTACGGCTTGGTGAAACACGCCGTTGCCATCGATCTACACCCACGCGACCTACTCTCTGAAAAAGTCGACCGGCAGTGCCTTGGCAA None
TACACCCACGCGACCTACTCTCTGAAAAAGTCGACCGGCAGTGCCTTGGCAAAGTGCCAGCCTTGTGCGGCTTTACAGCCGAAGGCGCGCAACCGGGCGGCT None
AGCACCAATGATGGACAGCAAACAACGTCGGCAACAGGTCAAATTCTCTCAAGTAGTCACAACCCCAGATGCAAAGTGCACCAGCCGCCCTGCCGCGAAGCT None
CTCAAGTAGTCACAACCCCAGATGCAAAGTGCACCAGCCGCCCTGCCGCGAAGCTAAATCCAGCTGAACAATCTGAACATCAGGTAAATACAGTGGCAACTA None
CATTTCGGCCGCCATTTGGCCGTCCCTCCTACGGACCGATGTAGCAAACGGGTCAACGTGCGCAGACCAATTCGCCAGGCAACGCAACCAGGTTATCAACGT None
CTCCTACGGACCGATGTAGCAAACGGGTCAACGTGCGCAGACCAATTCGCCAGGCAACGCAACCAGGTTATCAACGTGCCCTACCAGCTTGCCGGAAAAGCA None
GTGCGCAGACCAATTCGCCAGGCAACGCAACCAGGTTATCAACGTGCCCTACCAGCTTGCCGGAAAAGCAAAAGTGCGTTTGGGGCAGGCCGCCACTTATGT None
GCATCGATTTCGACAACATCAAGTACTTCGTGCGCTCCACCGAGAAGCAGGCCGCGAGCTGGGATGATTTGCCAGAGGACATCCGCAACACCTACGACCGGT None
TTCGTGCGCTCCACCGAGAAGCAGGCCGCGAGCTGGGATGATTTGCCAGAGGACATCCGCAACACCTACGACCGGTTGGGAATCCCGGAGGCCGAGAAGCAG None
GGCCGCGAGCTGGGATGATTTGCCAGAGGACATCCGCAACACCTACGACCGGTTGGGAATCCCGGAGGCCGAGAAGCAGAGATTAGTAGCTGGAGTAGCCGC None
TTTTAGACACTGATACTGGTTTGCGAGAACACCCGGATATTTTCAAGGAATATTTCGGTACAGTAATCCCTGCCGGCGATAATAAGTTTTCTGCATTGAATA None
TCGGTACAGTAATCCCTGCCGGCGATAATAAGTTTTCTGCATTGAATACTGCAGTTTGGAGTGGTGGGTCCTTTATTTACGTCCCGCCCGGTGTTCACGTCG None
TGGGGTACACACTGGATTGGCGAGCGATCCGTGGAGCCGAACCCGTTGCCACCGCCATTCTGCGTCGGTTAGTCTCTTTTTCGACCTTGGGGCGCGGAGGGT None
TGCGTCGGTTAGTCTCTTTTTCGACCTTGGGGCGCGGAGGGTCGTTATGGTGTGTCACAGTGCTTTGCTGTCAAAGGCATTGGCGGTGCCGACCAAGCGACA None
TGGGCGGTGAACTGATTCGCATGTTGACCGGCGATCATTTCTTTGCCGGCGCCTATACCGTTCTGTGGACGTCTATCACGGTGTGGCTGATCGCCCTTGCCG None
ACAAGGCGAATCTGTACTGCGTTGGCCATCGGTCCGGGGACCGTCTCAGTATTGTTGCTCGCTGTGGTCGGGCGTCGCGATATCGCGGACCAGTTGTGTGCC None
GTTGGCTTCCGCGCACTATTCGGTGCATTCCTCCTCGGGTTGCTGTTCTTCGTTGCCACGACATCGATGATCCGCTATGTCTCCGCCGTGCCGGTCAGAACC None
TGCATTCCTCCTCGGGTTGCTGTTCTTCGTTGCCACGACATCGATGATCCGCTATGTCTCCGCCGTGCCGGTCAGAACCTTCTTTGCCGAACTGCGCGGCAA None
TGCCACGACATCGATGATCCGCTATGTCTCCGCCGTGCCGGTCAGAACCTTCTTTGCCGAACTGCGCGGCAATCTGGCGTTGCCGGTGCTGGCATCGGCATT None
CGACGGTGCGCAAGGTCCGCTCCGAGCTCGAGCGTCGGGTCCGCGCCGGCGAACTGACCCCGGCCCTGGCGGCTCAGCAAATACTGGAGATAGCTAACCTAA None
GGCGAACTGACCCCGGCCCTGGCGGCTCAGCAAATACTGGAGATAGCTAACCTAACGGATAGGTAAATAAATCCGTGTTTGCCGATGGTCGCTGCGAAATCC None
AACCTAACGGATAGGTAAATAAATCCGTGTTTGCCGATGGTCGCTGCGAAATCCACGTAAGTTCGACCGTGTGATGGTTGACACCGGAGTCGATCACCGCGC None
TTTTTGACTCTACGCTTTGGCATGCGGCTGGCCGAAACACCTCCGGCAAAGACCGCTTGGCCATAAATCATCAGTTTACGCGCTCGTTTTTCAAGCAGCAGA None
TTGGCCATAAATCATCAGTTTACGCGCTCGTTTTTCAAGCAGCAGATCGACTACGTCCGCGCGCTGGGCGACGCCGTGGTTCTGGAGCAGCCTGCGCGTACT None
ACGCCGTGGTTCTGGAGCAGCCTGCGCGTACTCAGCAACTGCTCGGATGGTACAGTCGAGTGGTTACCAATCTGGACGAGTATTACCAGCCGCCGGACAAGC None
TGTAGGTGGCCGGATGATCCACTTAGACAGGCCGTGGAAGCAGAATTTGCGCGTCCCGATGGCGTTGCGGTGGCGTAATGGCCTGGCGAAAGCTCGGGAGAA None
ACAGGCCGTGGAAGCAGAATTTGCGCGTCCCGATGGCGTTGCGGTGGCGTAATGGCCTGGCGAAAGCTCGGGAGAATTTTTGCTCCGTCGGGCGAACTCGAC None
CCGATGGCGTTGCGGTGGCGTAATGGCCTGGCGAAAGCTCGGGAGAATTTTTGCTCCGTCGGGCGAACTCGACTGGTCGCGAAGTCATGCTGCGCTACCGGT None
AGGATCGCGTGCATATCGACACAAGCGGATCCGACAATAGCGCGGCCTGTAGGCCGTACGTCGTCCGCGATGCGGGAGTATACAGAATGTGGTTTTGCGCTC None
AGTATACAGAATGTGGTTTTGCGCTCGCGGTGCGAAATATCGGATTTACTGCGCTACATCGGAGGATGGTTTGACTTGGCGGCAACTCGGCAAAGATGAGGG None
CGCTACATCGGAGGATGGTTTGACTTGGCGGCAACTCGGCAAAGATGAGGGCATCGACGTTTCGCCAGATAGCTGGGACTCGGATATGATCGAGTATCCTTG None
GAGGGCATCGACGTTTCGCCAGATAGCTGGGACTCGGATATGATCGAGTATCCTTGCGTGTTCGATCACAGGGGACAGCGCTTTATGCTTTATTCGGGCGAT None
GGACAGCGCTTTATGCTTTATTCGGGCGATGGCTACGGTCGCACCGGGTTCGGTTTGGCGGTGCTGGAGAACTGATCAGGGCTGACAATAGATGTTTAGCGG None
CGCTCGGCTTCCTCGAACTGAGCCCATAGAAAGGCAGCGACTAATTCGCTGGGCAAATAGGAAGACCCTTTGTCCTGCCACGTATATTTGTCGACCTCGTTG None
ACCGATGGTGATATGGTCGCGTAGCGTTGCATTGACGCCAATGAAAGATTGCTCCTCTATTACCACGCCACCGGATACGACGATATGAGACGCTAGAAAACA None
GATTGCTCCTCTATTACCACGCCACCGGATACGACGATATGAGACGCTAGAAAACAGTGATCGTGAATCGTCGAGTGATGGCCGATATGATTGCCGCTCCAC None
CCGGATACGACGATATGAGACGCTAGAAAACAGTGATCGTGAATCGTCGAGTGATGGCCGATATGATTGCCGCTCCACAATGTGACGTTGTTGCCAATCGAT None
ACAGTGATCGTGAATCGTCGAGTGATGGCCGATATGATTGCCGCTCCACAATGTGACGTTGTTGCCAATCGATACGAATGGCTGGATAGTGTTGTCTTCAAG None
CGGGCTGAGGGGCCAGAGACATATTCGGTCGCTGCGGCCTGTTGGCAGAGGTTGGCCAGTCTCTCGGTCTTGCCGTCGGCTAATTCGTAGTCCCACGAATTT None
GTTGGCCAGTCTCTCGGTCTTGCCGTCGGCTAATTCGTAGTCCCACGAATTTGCCAGTCGCGTGCTGATACCGAGATAACTGCAAATCGCATTCAATAGACG None
GCGCGATGAACGTCGCATCGTCTCCTGTGAGATAATTGCATCCGATCATATAGGGCTGGCTGCGGCTAGGTTGCTGGCAAAAAGATATCGCGGCCGATCCGT None
GGGCTGGCTGCGGCTAGGTTGCTGGCAAAAAGATATCGCGGCCGATCCGTTTCTGGTTTTGTCTTGATGATCAAATCCGCTTCCGTTCACGAGATCGATTCC None
ATATGTGGCCGCTGGTAGCCCGGCCGAGGTCTATTTCTGCTGGGCGACACGGAATTATCGCGAATTGTATGGGTTGCTCGCGGTCAACAGCATCTGGTTCAA None
CTATTTCTGCTGGGCGACACGGAATTATCGCGAATTGTATGGGTTGCTCGCGGTCAACAGCATCTGGTTCAATCACGAATCACCGCGTCACGGCGAGACATT None
CGCCGGCCCACCCGGATAGGTATCAGTATTGGGGCGTTCCGGCCAGCGTACGAGGCGTGATCGACCGCGCAATGGGTGTTTGCGTTGAGTAATAATCTGAAC None
GTACGAGGCGTGATCGACCGCGCAATGGGTGTTTGCGTTGAGTAATAATCTGAACCGTGTGAACGCATGCATGGATGGATTCCTTGCCCGTATCCGCTCACA None
GGGCAATACGGGCATGGATGACCCGAAGGGAGTCTGGCGTTCGCTCAACTGGATTACGGTTCCCAAGGTGAAACGCTTTGCGGCGAAGGATGCGACGCTGAC None
CGGTTCCCAAGGTGAAACGCTTTGCGGCGAAGGATGCGACGCTGACCTTGCGCTTCCACCGTGCAATGTTGGTATGGATGCTGGAACGCGCGCTGACGGATA None
CTGACGGATAAGGAATTCGCTGGTCGCCGGGCACAATGGATGGTCGCTGCTATTCGCTCGGCGGTGAAATTGCGTGTGCATCATCTGGCAGGCTATGTTCCC None
GCATTCGCGCGGCACTTTCGCAACCTGCTGTGTATGAGGCGTATCAGCGGATTGCGGGCGCTAAAAGCGGGCTTGCGTGGATCACAACCGACCCCATCCAGT None
GAACAATCCGGTGTTGAGATCGCCCGAGTTGAAGAAGCCGGTGTTGATGTTGCCGGAGTTGAAGTAGCCGGTGTTCACGTTGCCCGAGTTGAAATCGCCCGT None
GTTGATGTTGCCGGAGTTGAAGTAGCCGGTGTTCACGTTGCCCGAGTTGAAATCGCCCGTGTTCATGCTGCCGGCATTGAAGCTACCCGTGTTGGTATGGCC None
CCCACACCTGGGAAGAGCGCTGGCAGACGCTATCGATGGTGCGTGACGCGGGCATGGAGGTTTGCTGCGGCGGCATCCTCGGCATGGGGGAGACGCTGCAGC None
AGACGCTATCGATGGTGCGTGACGCGGGCATGGAGGTTTGCTGCGGCGGCATCCTCGGCATGGGGGAGACGCTGCAGCAGCGCGCGGAATTCGCCGCCGAGC None
GCCGACGAATCGGGAGTACTCGCTCCAGTTCATGCCGAACTGAAATTCCTGCACGATTCCGGTCGCCACGCCGATGGCAAAGTTGATCAGGAACAATTTGCC None
GTTCATGCCGAACTGAAATTCCTGCACGATTCCGGTCGCCACGCCGATGGCAAAGTTGATCAGGAACAATTTGCCGAAGAATTTGGTGAGGCGATACCAGGC None
ACGATTCCGGTCGCCACGCCGATGGCAAAGTTGATCAGGAACAATTTGCCGAAGAATTTGGTGAGGCGATACCAGGCGGGGTTATCGGTGACGACCCACAGC None
AGTTGATCAGGAACAATTTGCCGAAGAATTTGGTGAGGCGATACCAGGCGGGGTTATCGGTGACGACCCACAGCGTTTGCATGACCGCGATCAGCGGGGCCA None
TGCGGGTTTGGGCGGCCGGCGGGTGGAGTTGCCGACGTATGGATTTGCCCGGCAGCGGTTTTGGTTAGGTGACAATGGCGAGTTGTCGGTGGACCAGACGGG None
CGGTTTTGGTTAGGTGACAATGGCGAGTTGTCGGTGGACCAGACGGGCAAAGACGCCGGCGCAATTGCGCGATTGCAAAGCCTAGCCCCACCGGAACTGCAG None
GCGATTGCAAAGCCTAGCCCCACCGGAACTGCAGCGCCAGCTGGTAGAGTTGGTGTGCTTCCATGCAGCAATCGTTTTGGGTCGCAAGAGCAGCCATGACAT None
CCGTCCTGGCAGGCTCAAATTATGCTATCGGCATAGGTGCAAATACGACAGGCGTTGAATAGCGATGTTTTTGCGAGATCGCGTAATGTGGCTTAAACTTTG None
GATCGCGTAATGTGGCTTAAACTTTGGGCTTCGAGGGTGGCAAGTAACTTAAGTGGGCAGGGGCATGAGCGTCATCGCGGGTGTGTTCGGTGCGTTGCCGCC None
AACTTAAGTGGGCAGGGGCATGAGCGTCATCGCGGGTGTGTTCGGTGCGTTGCCGCCGCATCGCTATAGCCAAAGTGAGATCACTGATTCGTTTGTCGAGTT None
GCCGCCGCATCGCTATAGCCAAAGTGAGATCACTGATTCGTTTGTCGAGTTTCCCGGCCTTAAGGAACACGAGGAGATCATTCGGCGTTTGCATGCCGCCGC None
TGATTCGTTTGTCGAGTTTCCCGGCCTTAAGGAACACGAGGAGATCATTCGGCGTTTGCATGCCGCCGCCAAGGTCAACGGTCGACACCTGGTGCTGCCGCT None
AGGAGATCATTCGGCGTTTGCATGCCGCCGCCAAGGTCAACGGTCGACACCTGGTGCTGCCGCTGCAGCAATACCCGTCGCTGACCGACTTCGGCGACGCCA None
GAACCCGCCGACGCCGATCGAGTTGATGGTTAGCTCCGGGGTGATGATTTCCTGGGTGGTGATCTGCGGCAGAGTGAAGCCGCCCACGCCGATCGGAGGGAT None
AGTGAAGCCGCCCACGCCGATCGGAGGGATCGCGAACTCCGGGGTGGTGATAGCTGGGGTGGTGATCTGCGGCAGGGTGAAGCCATCGACGTTGATAGCGGG None
CGAAGTTGCCCAAGCCGGTGTTGGCAAACCCGGTGTTGAGATTGCCAAGGTTTCCCACGCCGACATTGTTGCTGCCGAGGTTCCCGAAGCCGATGTTGTTAT None
CCCACGCCGACATTGTTGCTGCCGAGGTTCCCGAAGCCGATGTTGTTATTACCCAGGCTTGCTGAGCCGATATTGGAGTTACCGAAATTTCCGGACCCGAAA None
CAGGCTTGCTGAGCCGATATTGGAGTTACCGAAATTTCCGGACCCGAAATTGTAGTTGCCAAGGTTGGCGTTGCCGATGTTGGCAAGGCCGTTGTTGGCGTT None
CGACTGCAATACTGCAAGGCAAGGTCAACCACAACGATTTGGTCGCGAGGCAAGGCAAATGAAATCGGAGTTAGTCGAGCCGCAGCTCCCGGTGGGCTACCG None
GGCTACCGCGCCTCGGTGCCTACACCGACGGAGCTCCCCGCGCCACTGAAGCCACGGTGTAACACGTTTGCCATGGCAGGGGGTACAGGACGATGACCGCAG None
GGAGCTCCCCGCGCCACTGAAGCCACGGTGTAACACGTTTGCCATGGCAGGGGGTACAGGACGATGACCGCAGTAGCTGACGCACCTCAGGCTGACATTGAG None
GTGGCGCAGGGTGCCGTCATTCTCGAAAGTGCGATTCGGCAGCAAATTGCCGCCGGCAACAACGTCACCGTCTTCGGCTACTCGCAGAGCGCCACGATCTCG None
TGCCGGTGTTGAACAGGCCCGTGTTGGCGTTGCCCACGTTACCCAGGCCGGTGTTGTAGTTGCCGGAGTTGCCGATGCCGACGTTTCCGTTGCCTGAGTTGA None
AATATTTCCAGTGCCCGTGTTGCCGAAGCCGATGTTGCCGTTACCGATGTTCGCGAAGCCGTAGTTGTTGCCGCCGATGTTCCCAAAGCCAATGTTGTGCAG None
TGTTGTGCAGGGCCTCCGTCAACCCCGGACCCGTGTTTGCAAACCCAAGGTTGTTGCTGCCGACGTTTCCAAAACCGAAGTTGTTGCTTCCGATGTTTCCGA None
CTACCGAAGTTGTAGCTACCGACGTTTCCGCTACCCACGTTGTAGTCGCCGAGGTTTGCGTTGCCCAAGTTGAGTGTGCCGTCGTTGGCGAAGCCGAAGTTG None
AGCCATCCGGGAACACCGTAAACGGGCCTAACCCTCCACCCACATCAATACCCAACGGAATAGCCGGCAAACTATAACCACCCGATAAGAAGGTGATGGGAC None
TACCCAACGGAATAGCCGGCAAACTATAACCACCCGATAAGAAGGTGATGGGACCGATTTGACCACTCACTGTCACGTAATCTGGAGGGAATCCGGGGAAAA None
ACCACCCGATAAGAAGGTGATGGGACCGATTTGACCACTCACTGTCACGTAATCTGGAGGGAATCCGGGGAAAAATGGCGGAATCGCGGGAATCTCAGGAGT None
TGGGACCGATTTGACCACTCACTGTCACGTAATCTGGAGGGAATCCGGGGAAAAATGGCGGAATCGCGGGAATCTCAGGAGTGCCTAGCTGTATCGATATGC None
AACCCCTGCTGGTTGTCGCCGGTGAGGCCGAAGCCGATGTTTCCGTTGCCCGTGTTGCCGAAGCCGATGTTTCCGTTGCCGGTGTTGCCCAAGCCAACGTTG None
TTGCCCGTGTTGCCGAAGCCGATGTTTCCGTTGCCGGTGTTGCCCAAGCCAACGTTGTTGCTGCCGACATTTCCAAGGCCGAAGTTGTTGCCGCCGGGATTT None
AGGCCGAAGTTGTTGCCGCCGGGATTTAGGCTGCCCAAGTTCAAAATGCCAAGGTTAGCGGCGCCCATCTGTCCGAAGCCCGAGTTTGCCAGGCCTAAGCTA None
TTAGGCTGCCCAAGTTCAAAATGCCAAGGTTAGCGGCGCCCATCTGTCCGAAGCCCGAGTTTGCCAGGCCTAAGCTAAGATTTGCCAGCACACCCTTGGAAC None
CAAGGTTAGCGGCGCCCATCTGTCCGAAGCCCGAGTTTGCCAGGCCTAAGCTAAGATTTGCCAGCACACCCTTGGAACTGGTGATCGCCGCGGTGACGACGG None
GTAATGCCGTTAAGGCTAAAGGTGGGAAGATTGATGACACCAGAATTTGCTTGCGTGGCTATGCCGGGAGTGCTAAAGCCGCCTATACTTATTTGGGGTGTA None
AGTTAAACGCACCTACCGTGATGTTGGCTGGTGTCGTTGTAGCTGGAATCGTCAACGACGGCACCGTCAACCCCGGCAAATCAAACGCACCCACCGTGATGT None
GTCAACGACGGCACCGTCAACCCCGGCAAATCAAACGCACCCACCGTGATGTTAGCTGGCGTCATCGCCGCTGGAATCGTCAACGACGGCACCGTCAACCCC None
GCGTCATCGCCGCTGGAATCGTCAACGACGGCACCGTCAACCCCGGCAAATCAAACGCACCCACGGTAACGTTGGCCGGCGTCGTCACCGCCGGAATCGTCA None
AATCCGGTGTTGCCGTGTCCGGGGTTGAACAGGCCAGTGCTGAAGTTACCGGAGTTCCCGATGCCAAAGTTGCCATTGCCGGAGTTGAAGAAACCGATATTG None
CGACGTTACCGTTGCCGGAATTGAGTCCGCCAATGCCGATTTGGTTGTTTCCAGTCAGGCCGTTGCCGATATTGTTGTTGCCGGTGTTCGCAATTCCGAAGT None
GTCAGGCCGTTGCCGATATTGTTGTTGCCGGTGTTCGCAATTCCGAAGTTGCCGATGCCTGCATTGGCGAATCCCGTGTTCAAATTGCCCAGGTTTGCAAGT None
GAAGTTGCCGATGCCTGCATTGGCGAATCCCGTGTTCAAATTGCCCAGGTTTGCAAGTCCGAAGTTGTTGGCGCCCGCGTTTCCTATGCCGATGTTGTTGCC None
TAGGTTGGCCGAGCCGATATTGAAGCTACCGAAGTTGCCGGACCCCAGATTGTTGTTGCCAAGGTTGGCGTTGCCGATGTTGCCGAGCCCATTGTTGGCATT None
AAAAGCGACCAAAGCGAGCAAGTCGCGGATGCGGTGAACTATTTGCGGGATCGGCTGACCGAGATCGCACAATCCGGCAATCAGCAAATCAACCAAATCCTG None
GATCGGCTGACCGAGATCGCACAATCCGGCAATCAGCAAATCAACCAAATCCTGGCCGGCAAAGGGCCGATAGAGGCCAAAGTTGCCGCGGTGAACGCCGTC None
AAATCCTGGCCGGCAAAGGGCCGATAGAGGCCAAAGTTGCCGCGGTGAACGCCGTCATCGAGCAGTCGAATGCCATGGCCGACCATGTGGGAGCAACCGCGA None
GTGGAAGGAGAAACTGCGTCCATCGCCGACTTGCCCATACCCGCTGGCGAAAATTCCCGTCGATATATCTTCAACAGCAAACTCTTCGCGCTTGTCTGCGAG None
CGACTTGCCCATACCCGCTGGCGAAAATTCCCGTCGATATATCTTCAACAGCAAACTCTTCGCGCTTGTCTGCGAGATGCCGGTCAGCGGTGACGGTCATGC None
AAAATTCCCGTCGATATATCTTCAACAGCAAACTCTTCGCGCTTGTCTGCGAGATGCCGGTCAGCGGTGACGGTCATGCCCAGAGAATACCTCTGGAGTACC None
CCACGTTTGCCGATAGGCGGCTTACTGAACGCCACATTGTGGACGTCGGCAGGTGTAAGCGGCATTGTTTGTCCCCTCGAGTTCCTGGACGGTCAAACGATC None
GGTCAAACGATCTGGAAGTGTAGAACGGAGTGGTAGCCGTGGTGCAACTACCGTCCATCCTGTCACACCAGACTCGGCGGTTGCCGATTGGACTAAGTAAAT None
GCCGCCAACAACCGATTAAGTTCGGCCATCTTGGCTGAAGCTTCCTGTTCGCGCGATTCGCCAACGGACCGACAACCCAATCGAAACAAAATCGCAACATCG None
CCTGTTCGCGCGATTCGCCAACGGACCGACAACCCAATCGAAACAAAATCGCAACATCGGTTGCTGGAAAGAATTTGGTAATCGGTAGAAGTTCAATTTCGC None
AATCGCAACATCGGTTGCTGGAAAGAATTTGGTAATCGGTAGAAGTTCAATTTCGCCGACATTGCGACCCGCCGCCTCCGCGGCCGCCGCAAGTCGCGATCG None
CTCGGGTACTGCCATCACATCGCGCGTGCATTCGCTGAATCGGCCCAACATGGTCAGTGTCGGCACCATAGTGTGGCTATCCAGTGAATTAATGTTCTTTGC None
TCAGTGTCGGCACCATAGTGTGGCTATCCAGTGAATTAATGTTCTTTGCTGGGCTGTTCGCGTTCTATTTCTCGGCACGAGCTCAGGCCGGCGGGAATTGGC None
AACAACGCCGACGGCAAACCGCCTCCGAGCAGACACTGCTAGCCTTCGATCATCACGCTTACGACTCCGCGTCCCAGCAAAGCGTACCGAGTACATCGCCAG None
CTGCTAGCCTTCGATCATCACGCTTACGACTCCGCGTCCCAGCAAAGCGTACCGAGTACATCGCCAGCCGGGAAGGGATATGGTCCCGCGACTAGCGGATCA None
CATCACGCTTACGACTCCGCGTCCCAGCAAAGCGTACCGAGTACATCGCCAGCCGGGAAGGGATATGGTCCCGCGACTAGCGGATCAGCAGAGTGCGCAGTT None
TACCGAGTACATCGCCAGCCGGGAAGGGATATGGTCCCGCGACTAGCGGATCAGCAGAGTGCGCAGTTCCAGTGCTCTGGCAAACCAACACGTATTGCTCGC None
AGCGGATCAGCAGAGTGCGCAGTTCCAGTGCTCTGGCAAACCAACACGTATTGCTCGCCGATCCAACATATTCGTTGAACCTTGAGAAAGGCTTGCGGCGCA None
GTTGAGATCGCTGAGGTATCGGCCATGGATGTCCCTCACGAGCAGCCAGCCCTCTCTTCGAGCAAATCGAATCGCTTTACTTCGCAAAGGCAAACAACTGGT None
GGCCATGGATGTCCCTCACGAGCAGCCAGCCCTCTCTTCGAGCAAATCGAATCGCTTTACTTCGCAAAGGCAAACAACTGGTGTGGGAACCACCACTGTTGA None
CGCGCTGCGGGTAGGCCACTGCGACGATTCAAACACGGTGTCACACGGTGAATAGTGTCGAGATGGGCTCTGATCAACCGTCGCAAACCCGGTTTCGCATCG None
AGTGTCGAGATGGGCTCTGATCAACCGTCGCAAACCCGGTTTCGCATCGATAGCGGAATCGCACCGGGTTGCATGGAGGCTGCTGACCTTGGAAAACAAGAT None
TATTACGACCACCTGGTCGATACGCTCGTACTGGACCAGAGCCATATCCAGCACATTCAAGACTTTTGGCGTGATCCCCTGACGGCGGCGGGTGCGGTCAGC None
GGCGGGTGCGGTCAGCGCAGATGGTAAGGCGGCGTACGTTCAACTTTACCTCGCCGGCAACATGGGTGAAGCACTCGCAAACGAATCCGTTGAAGCCGTCCG None
GTTCAACTTTACCTCGCCGGCAACATGGGTGAAGCACTCGCAAACGAATCCGTTGAAGCCGTCCGGAAAATTGTGGCGAATAGTACACCGCCGGAAGGCATC None
CCGGAAGGCATCAGAACCTATGTCACCGGACCGGCGGCCTTGTTTGCCGACCAAATCGCCGCCGGTGACCGAAGCATGAAGCTGATCACCGGATTAACGTTC None
GTTTGCCGACCAAATCGCCGCCGGTGACCGAAGCATGAAGCTGATCACCGGATTAACGTTCGCGGTAATCACCGTGTTGCTGCTGCTCGTCTATCGCTCGAT None
GCGACGCGTGGCACCATTGCCTTTCTTGGATACCACGGAATGGTCGGCCTTTCGACTTTTGTGGTCAATATCCTCACGGCACTTGCCATTGCTGCCGGTACA None
ATGGTCGGCCTTTCGACTTTTGTGGTCAATATCCTCACGGCACTTGCCATTGCTGCCGGTACAGACTACGCGATCTTCCTGGTCGGCCGCTATCAAGAAGCC None
ATCAAGAAGCCCGCCATATCGGCCAGAATCGCGAAGCCTCTTTCTACACGATGTACAGGGGCACCGCTAACGTCATTCTCGGATCGGGACTGACCATCGCCG None
TCGCGAAGCCTCTTTCTACACGATGTACAGGGGCACCGCTAACGTCATTCTCGGATCGGGACTGACCATCGCCGGCGCAACATATTGTCTGAGTTTCGCCCG None
GGAACAGATGCTCGACTTGGTGCAGCAGCTCAACGACGTTACCCATGAGATGGCAGCCACGACGCGCGAGATCAAAGCTACTACCAGCGAACTGCGAGATCA None
TGGCAGCCACGACGCGCGAGATCAAAGCTACTACCAGCGAACTGCGAGATCACCTTGCGGACATCGACGATTTCGTCAGGCCGTTGCGTAGCTATTTCTACT None
GATCACCTTGCGGACATCGACGATTTCGTCAGGCCGTTGCGTAGCTATTTCTACTGGGAGCACCATTGCTTCGACATTCCGTTGTGCTCGGCGACGCGATCA None
TTCCTCCGGAAGCCTTCGATAATGCAGAATTCCAGCAAGGCATGAAGTTGTTTTTGTCGCCGAATGGTAAGGCGGTGCGCTTCGTAATTTCCCACGAGAGCG None
TTGTTTTTGTCGCCGAATGGTAAGGCGGTGCGCTTCGTAATTTCCCACGAGAGCGATCCAGCAAGTACTGAAGGTATCGATCGCATCGAAGCGATAAGGGCC None
GGCGGTGCGCTTCGTAATTTCCCACGAGAGCGATCCAGCAAGTACTGAAGGTATCGATCGCATCGAAGCGATAAGGGCCGCGACCAAAGATGCCATCAAGGC None
AATGCCGGCGACGCGGCGTTGAACCCATTGGTGCTGGAAAGCGTTCCGAAATAGTGGTCGAATGACCGGTTCTCCTGCATCAGCAACACGATATGCTCGATG None
GTCGAATGACCGGTTCTCCTGCATCAGCAACACGATATGCTCGATGTCGGTCAAATGTCCGGGACAAGGCCCGGCGCCGTAGGCCTTTTCAATCACCGGTGC None
CGATCTCACCGGCCGGCTTCGGCGCTTAAGTCACTAGACAGTTCGAGGTCAGCGACGGGATATCGCGCTATCGGTAAACTAATTTCGTATCTGCCCAACCGC None
GGATATCGCGCTATCGGTAAACTAATTTCGTATCTGCCCAACCGCGCCGCCAATGCAGCGTCCGTACCATGTGGACTACGGTGCTGATGTTGACTCTGGTGG None
GTCCCAAAATTGAAAAATCCCGAACTCATCACGCCGGTCACAAAAATCCCGGTGTTGTTGACGGCCGCGTTATAGAAACCTGAGTTGCCGTAGCCCGTGTTG None
GTTGCCGTAGCCCGTGTTGAGCACCCCTGAGTTACCGCCGAACATGCTTGTGGTGCTGGTATTGACATAGCCCGAGTTGCCGAAGCCCGAGTTCTGAATGCC None
CCACCAGTATTGATGTTGCCCGAGTTCCCTAAGCCAGTGTTGACATCACCCGCATTGCCCACACCGGAGTTGACGTCGCCAGCATTGAGGAAACCACTGTTG None
CACTGTTGCCGTCACCCGAATTCCCAAAACTCGAGTTTATGTTTCCGGCGTTAAGACTGCCGAAGTTGTAGTTGCCAGCGTCGAAAAAGCCTGTGTTGCCGG None
GTTTATGTTTCCGGCGTTAAGACTGCCGAAGTTGTAGTTGCCAGCGTCGAAAAAGCCTGTGTTGCCGGCGCCGGCGTTAGCGAGGCCAGTGTTTGTGCTGCC None
GTGTTTGTGCTGCCGCCGTTCCAAAATCCGGTGTTGACGTTGCCCGCGTTCCCGAATCCAGTGTTCGCAGTACCGGAGTTCCCGAAGCCTACGTTGCCGGTG None
TGCCGGGCGACAAGTTTACCGATGGCAATGCCTATTCCACGATAAAGATTCTGAGCGGTATGCAGTTTGCTCGTAACTACATAACAGGTTTGAGCTGCCACG None
TGCCTATTCCACGATAAAGATTCTGAGCGGTATGCAGTTTGCTCGTAACTACATAACAGGTTTGAGCTGCCACGGAGCAATTGTCGTCGGCGGCTCGAGCGG None
ATGCGTAATCATCGAGACGATTACTTGCCTTGCCTTGTTTCGATACAGTTCCGCTTGTTGCCAGACGGCAAAGATTACGTCTTCCACACGACGTTCTATTCG None
TTCCGCTTGTTGCCAGACGGCAAAGATTACGTCTTCCACACGACGTTCTATTCGCGGTCCATGGACGCCTGGCAAAAAGGTCACGGCAATCTTTTGTCTATC None
CAGACAGGGCCGAAGCGGAGTCACAGCGTCTGGCCGACACACGTGGCGTCGTGTTTGCTAGGCATGGGTTTTGTGTTTGCTGTCCCCCACAACCCCAGACCC None
AACCCCAGACCCGTACAAATCCCCAGACCCCTACACACAGCGACACGGCGACCCGCCGTCTCCTGAGTGTGTTTGCTAAAATTTCGTTTGTTCTGGTCGATC None
GTTTGCTAAAATTTCGTTTGTTCTGGTCGATCACTTATTGTGTTTGCCGGTTTTGGCGATGGGCTTGATTCCTCTGACAGCAACACCAGTTGGCCCCTTCCT None
TGATCACGGTGAGCAGGATCGCGGCGGCCATCACTACCACCGCCGCAACGTGCAGCGGACCCGAAAGTGGCAACACGAATAAGCCAATTGCCACCGCCTGGA None
GTGCAGCGGACCCGAAAGTGGCAACACGAATAAGCCAATTGCCACCGCCTGGACAAAGGTCTTCAGCTTGCCGCCCCAGCTCGCGGGAATGACACCGCGCCT None
AAGAATCTCGTGACACTCTATGAAGCGGTTCAGGAATTCTGGGTGGCCGAGCACCCGGACCTCTATGGCAAAGTCGTCGGTTGCGGTGCGTTGCACGTGTTG None
CCGAGCACCCGGACCTCTATGGCAAAGTCGTCGGTTGCGGTGCGTTGCACGTGTTGTGGTCGGATCTCGGCGAAATCCGCACCGTCGCTGTCGACCCGGCCA None
CTTGGATATGCATAGTGACTCGCTGGAACGGCACACGCGGTTCTGCGCGTACCGCACCATTTGCTGGGCCGAACCGGCCCAGAACGTTCTCACTCTACACGG None
CCATTTGCTGGGCCGAACCGGCCCAGAACGTTCTCACTCTACACGGGCGACCGGCGGCATTTGCGTAGAACTCGCTTTGCCGAGCTACCCCGCCTCAGCTCC None
AATCGCAACCACGTTACGCTCGCGACCGCTCAATCGAGCAAGGCGCCGACCGCAAGCACCAGCAAACCTGAGACGCCGCGCACAAAGTGCGAAACCACTGGA None
GCGAAGCAAGCCGCACCCACGCTGTATATTTTCCCGCATGCCGGCGGCACCGCGAAAGACTATGTCGCATTTTCCCGAGAATTTTCCGCCGACGTAAAGCGG None
CCGCATGCCGGCGGCACCGCGAAAGACTATGTCGCATTTTCCCGAGAATTTTCCGCCGACGTAAAGCGGATTGCTGTCCAATACCCCGGCCAGCACGATCGT None
GCGGATTGCTGTCCAATACCCCGGCCAGCACGATCGTTCTGGCCTGCCACCGCTTGAGAGTATTCCCACCCTCGCTGACGAAATCTTTGCAATGATGAAACC None
ACCCTCGCTGACGAAATCTTTGCAATGATGAAACCGTCGGCTCGGATCGACGATCCGGTGGCATTCTTTGGGCACAGTATGGGCGGAATGCTAGCCTTCGAA None
ACGACGGAAGAGTTCTCTATCCGTGTATTCCCTGGGGATCACTTCTACCTCAACGACAATTTGCCAGAGCTAGTCAGCGACATAGAAGACAAAACACTCCAA None
CCTCAACGACAATTTGCCAGAGCTAGTCAGCGACATAGAAGACAAAACACTCCAATGGCATGATCGAGCTTAGCTATGCTCCGGATGTAGCTGGCCGAAGAT None
TATACGTACATCGACTACGGATCCGACCCCAAGGGATTTGCTGACAGCTTGACTTGGTCGCAGGTCTACAGTCGTGCATGCATCATTGCTGAAGAACTCAAG None
GTCCGGATCGACGCGTACGCCGGCCGGAGTCATTGTGTCGCACACGAATGTCATTGCCAATGTGACACAAAGTATGTACGGCTATTTCGGCGATCCCGCAAA None
TTGCCAATGTGACACAAAGTATGTACGGCTATTTCGGCGATCCCGCAAAGATTCCGACCGGGACTGTGGTGTCGTGGCTGCCTTTGTATCACGATATGGGCC None
CGTGGCTGCCTTTGTATCACGATATGGGCCTGATTCTCGGAATTTGCGCACCGCTGGTGGCCCGACGCCGCGCGATGTTGATGAGCCCAATGTCATTTTTGC None
CCGTGGAACCAATTTGTGGGTGGCGCCAGCTCGGGCGTCGCCAGCAACTTAGGGCAATACATCACGCCGTTGGTCACACTGCAGGCGGTCTCGTTCGCCGCG None
ACCGATGCTTCACGGGTTTGGTGATATCGCTAGTTTGCGGCTACGTCATCGGATTCCGTTTTCATCGCGGGGCCCTCTATATCGTCGGTTTTTGCCTACTGG None
ATTCCGTTTTCATCGCGGGGCCCTCTATATCGTCGGTTTTTGCCTACTGGTTATCGCGATCGGGGCTGTGCTGTCATTCGCCGCTGACCTGGTTGGCACCGT None
TTGCCTACTGGTTATCGCGATCGGGGCTGTGCTGTCATTCGCCGCTGACCTGGTTGGCACCGTTACCAGGAACCCAGACGCGATGCTGCCGCTGCTGAGCTT None
ACGACGACAAGTCAGGAAATCGAGCTTGCACCCACACGTTTGCCAGGCTCGCAAAACGCTGCTCGGCTGTTCGTTGCGCAGACCCTTTTGCAGACCAACCGG None
TCGGCTGTTCGTTGCGCAGACCCTTTTGCAGACCAACCGGTTGCTAACTCGATGGGCACGTGACTATATCACCGTTATCGGAGCGATCGTGTTACCGATTCT None
CCGTGCACCGAGCATCGGGCCTGATCTCTCGAATCCTGGCAAACGCGATTCGGACTCTGGTCACCACTTTAGTGATGCTAGGTACTGGGGTGGTATTGGGTT None
TTCAAAGAAGACGAGTATCCATCTACCGCGTATTTGCAATACACCTCCGGGTCCACCCGCACGCCCGCTGGCGTGGTGATGTCCCATCAGAACGTTCGGGTT None
TGGTGATGTCCCATCAGAACGTTCGGGTTAATTTCGAACAGCTGATGTCTGGCTACTTTGCGGATACCGACGGGATTCCACCGCCAAATTCCGCACTCGTAT None
ACTTTGCGGATACCGACGGGATTCCACCGCCAAATTCCGCACTCGTATCCTGGCTACCCTTCTACCACGACATGGGTTTGGTAATAGGAATTTGCGCACCAA None
TCGTATCCTGGCTACCCTTCTACCACGACATGGGTTTGGTAATAGGAATTTGCGCACCAATTCTGGGTGGATACCCCGCGGTGCTCACCAGCCCGGTGTCGT None
CAGCGGTAGCGAGCGGGTACAGGCCGCGACGATCAAGCGCTTCGCCGACCGCTTTGCTCGCTTCAATCTGCAGGAGAGGGTGATCCGGCCTTCATACGGGCT None
ATCAAGCGCTTCGCCGACCGCTTTGCTCGCTTCAATCTGCAGGAGAGGGTGATCCGGCCTTCATACGGGCTCGCAGAAGCAACGGTGTACGTGGCGACGAGC None
AGGGTGATCCGGCCTTCATACGGGCTCGCAGAAGCAACGGTGTACGTGGCGACGAGCAAACCGGGTCAACCACCGGAGACCGTCGACTTCGATACTGAAAGT None
CGCAGAAGCAACGGTGTACGTGGCGACGAGCAAACCGGGTCAACCACCGGAGACCGTCGACTTCGATACTGAAAGTTTATCCGCCGGCCATGCGAAGCCGTG None
ATCTGGGTGCACGGCGACAACGTCGCTAATGGCTATTGGCAAAAACCCGACGAGAGTGAGCGCACGTTCGGCGGAAAGATTGTCACCCCTTCGCCGGGCACA None
GAGTGAGCGCACGTTCGGCGGAAAGATTGTCACCCCTTCGCCGGGCACACCCGAAGGTCCTTGGCTAAGAACGGGCGACTCAGGTTTCGTCACCGATGGCAA None
TTGTCACCCCTTCGCCGGGCACACCCGAAGGTCCTTGGCTAAGAACGGGCGACTCAGGTTTCGTCACCGATGGCAAAATGTTCATCATCGGTCGGATCAAAG None
CGAAGGTCCTTGGCTAAGAACGGGCGACTCAGGTTTCGTCACCGATGGCAAAATGTTCATCATCGGTCGGATCAAAGATCTCCTAATTGTGTACGGACGCAA None
TCGACAACCTGCGACGTCGGATCACCGGATTCCGTTGGGCGGCTGCCAGACATTTGCTGGGCGACATACTCGGCGACCGCAGTGGGAGTGGGATGATCGAAA None
CCGGATTCCGTTGGGCGGCTGCCAGACATTTGCTGGGCGACATACTCGGCGACCGCAGTGGGAGTGGGATGATCGAAAATCACGGTAGGTGGCAGCGTCAGT None
CCGCTCGGCAAGACCCAGCTCAAGGGCCTCCCCGGCTGACACCACACATCGAAGCGAACGGAAGGAATCAGGAGAACATGAGTCGATGACTCTGGCAAAGAA None
ATCGAAGCGAACGGAAGGAATCAGGAGAACATGAGTCGATGACTCTGGCAAAGAAATTTGGCACACCGTAGAGCACCGATGGCCCAAATCGCGCGCTTAGAA None
AACATGAGTCGATGACTCTGGCAAAGAAATTTGGCACACCGTAGAGCACCGATGGCCCAAATCGCGCGCTTAGAATGGCCGCTGCTTCTGGAGTTACCGGCG None
TCTTTCGGGAATTCTGATACCCGTGGAGCGCGAGCCAACCTGGCAAATCTCCGACCCAGACTTTAGCCTCTTCCTTGAAGGTCTCGATGTGGCTGGCTGCCA None
CATAACCTCGCCGAGAGGATCGTTTGTCTGCGTCAACCTTGTTATAATTGCAGCCGGCAACCGATCAATCGCAATCAACGACTCCGCGGCTACAAATAAGTG None
CTAGCTGCTCGAATTCGGATAGCTTCGGTGAAACATCGTGAATCCGCTGCTTGACGATTTGCACGATCACCTCATCGTCAGCGACAATGTTGAGAACCCTAG None
CTATCCGGACCGTTTACGATCTTGGAAAGCAAAGCGTCAACGGATCCACTTTGGGATTGCCGGCAGCATGCGTTGGGCGATTCTGATGGAACGGTTACGATC None
TTACGATCAATATCGCAGGAAACGCCGGTCAGAGCAGTTCCGTCTTGCCCATGCTGAAAAGTCATCAGAACGCTTTTCCCCCGGCAAACTATGTCGGTACCC None
TGAAAAGTCATCAGAACGCTTTTCCCCCGGCAAACTATGTCGGTACCCAAGAGGCGTCCATACATCGACTTGATTCCGTGGCGCCAGAATTTCTAGGCATGA None
TCCGCGCAGATCGCCTGGGTCGAAGATGGTGCAGACGAAACGATACGCCGGCTTGACCGCAGCTAACACAAAGAAAGTCGCCATGGCCGCACCAATGTTTTC None
CGAAGATGGTGCAGACGAAACGATACGCCGGCTTGACCGCAGCTAACACAAAGAAAGTCGCCATGGCCGCACCAATGTTTTCGATCATCATCCCCACCTTGA None
TACGCCGGCTTGACCGCAGCTAACACAAAGAAAGTCGCCATGGCCGCACCAATGTTTTCGATCATCATCCCCACCTTGAACGTGGCTGCGGTATTGCCTGCC None
ATCTCGAGGCAGCCCGTACCCGCAGGCAACCTCCCAAAAATGCAATCCCCCAAAATGCAATGCGTCGAGCTATTTCTCACACCGACCGCTAGTTGCGGATCA None
GCAGGCAACCTCCCAAAAATGCAATCCCCCAAAATGCAATGCGTCGAGCTATTTCTCACACCGACCGCTAGTTGCGGATCAGAAATCCGTTGGGCGCGGAAG None
AAGTACCTTGAATGGCTGGCCGATCTGCCTCATGATGTTGGCAAAATACACCGCCGAGCCGCCGTAGCGGGTGCCGAACTCGATGACGAGGGATGGTTGCAA None
CCGAGCCGCCGTAGCGGGTGCCGAACTCGATGACGAGGGATGGTTGCAACTCGCTCAGGATCTCCTGGTAATTCCACATATCGCTGACGGATTTCCAGCAAT None
GAACTCGATGACGAGGGATGGTTGCAACTCGCTCAGGATCTCCTGGTAATTCCACATATCGCTGACGGATTTCCAGCAATTGATCCCCATATAAGTGGTCTT None
AACTCGCTCAGGATCTCCTGGTAATTCCACATATCGCTGACGGATTTCCAGCAATTGATCCCCATATAAGTGGTCTTCGTCCACACTAAGTTGCCGTAGTAC None
TTCCACATATCGCTGACGGATTTCCAGCAATTGATCCCCATATAAGTGGTCTTCGTCCACACTAAGTTGCCGTAGTACCACTTGTGGTATTCTTCCGCCACT None
CCAGCAATTGATCCCCATATAAGTGGTCTTCGTCCACACTAAGTTGCCGTAGTACCACTTGTGGTATTCTTCCGCCACTGCGTCGCTCGGCCGGTAGAATAA None
GTACCACTTGTGGTATTCTTCCGCCACTGCGTCGCTCGGCCGGTAGAATAACTGGGCCGCAAAACTCGCCACTAACCTGACTAGTCCGATCAGTTGCCCTAC None
GAAACGCCGCCGCGGACTCTCCCTGATGAAACGCCTGCGCCGACATCGCCTGCTGCTCGGCCTGACCGATCGTATGCCGCATCAACCCCGCCTTAGCGGCAA None
CTGCTCGGCCTGACCGATCGTATGCCGCATCAACCCCGCCTTAGCGGCAAACGCCGTATGCGAAGCGATCAACTGCGGAATATGGGCATCCAACAAACTCAT None
CATGTGCGCGGTCGGCCTGGCGGAACCGGATCAGGCGGCGATACCGAGTTGCTGGTTAATCTGCGGCCAGGACAGCAAACCCCAGGGGGTGAGCAGTATCCA None
GGCGGCGATACCGAGTTGCTGGTTAATCTGCGGCCAGGACAGCAAACCCCAGGGGGTGAGCAGTATCCAGTCGTGGATTTGCCAGGGGGCCAGTACGAAGCT None
TGGTTAATCTGCGGCCAGGACAGCAAACCCCAGGGGGTGAGCAGTATCCAGTCGTGGATTTGCCAGGGGGCCAGTACGAAGCTGAACGGCGCTCCTTGGACT None
GGGGTGAGCAGTATCCAGTCGTGGATTTGCCAGGGGGCCAGTACGAAGCTGAACGGCGCTCCTTGGACTACGGCTGTGTGCTCGAGGACAACCGCTTGTTGT None
GGACATCACCTCCGGCAACGCAACAACATAAGACACCACGCCGCTCCCGCCACCTCACGGCAACTTCCCCAGTTGCCCAGCCACTACCGATCGCCGAGTAGC None
AACTTCCCCAGTTGCCCAGCCACTACCGATCGCCGAGTAGCCGGAGCTTATGCCCACGCCGAGTAGTCACGTGCCAGTTTGCGCGAATTCCCAAAGTTAGAC None
CGCCGAGTAGCCGGAGCTTATGCCCACGCCGAGTAGTCACGTGCCAGTTTGCGCGAATTCCCAAAGTTAGACCGGCAAACGTGACGGCACCGATCCGTGTGG None
CACGCCGAGTAGTCACGTGCCAGTTTGCGCGAATTCCCAAAGTTAGACCGGCAAACGTGACGGCACCGATCCGTGTGGTGCAGCCGCCGGGAATCGAACACT None
CAGTGCAATTTGCGATGCCGTTATTGTATGCCCGAAGAGCACTACACATGGTTGCCGCGGCAAGATTTGCTATCCGTCAAAGAAATCAGCGCCATTGTAGAT None
GTAAGTAAAGTTCGAATCACCGGTGGCGAACCGCTGATCCGCCCAGATTTGCCGGAAATAGTGAGGACATTGAGCGCAAAGGTCGGCGAAGATTCAGGTCTG None
CACAAAAATAGACACAACGGTGATGCGTGGTGCCAATCACGATGAGCTGGCTGATCTGATCGAATTCGCTCGGACTGTTAACGCGGAAGTCAGGTTCATTGA None
CGCAACTCACTGGGCATGGGAGAAGGTCTTTACCAAAGCGAACATGCTCGAGTCCCTTGAGAAACGGTATGGACGTATTGAGCCTTTGCCCAAACATGATAC None
CGCCAATCGATATGCGCTTCCGGACGGAACTACCTTCGGAATTATCGCGTCGACAACGGAGCCATTCTGCGCAACCTGTGACCGTTCACGGTTGACCGCCGA None
CGTCCGTCGAGGCGATGTATGCGACAGAATTCGCTGACAGGCCAGCACGATGATCGACCATGCACTCGCGCTGACACATATCGATGAGCGTGGTGCGGCACG None
GGTGCGGCACGAATGGTCGATGTGTCCGAGAAACCCGTGACTTTGAGGGTTGCCAAAGCGTCAGGGCTCGTGATCATGAAGCCGTCTACCTTGAGGATGATT None
GCACTGGAAATTTTTGGCGATCACGACCTCATTGTTGACGGCACAGACAACTTCACGACGCGCTACCTGATCAATGATGCCGCGGTCTTGGCCGGCAAACCA None
CGACGCGCTACCTGATCAATGATGCCGCGGTCTTGGCCGGCAAACCATATGTTTGGGGGTCGATCTACCGATTCAACGGCCAGACCAGTGTGTTTTGGCCCG None
GTGCGGTTGAAGAAATAGTCCGGTTTAATCCGGCAACTGAAATTGAGCACTTGCGAGTTGTCACCGAGGATGTCGTCATTGCCGGAACCGCGCTATCGGCGG None
TAGTCCGGTTTAATCCGGCAACTGAAATTGAGCACTTGCGAGTTGTCACCGAGGATGTCGTCATTGCCGGAACCGCGCTATCGGCGGGGAGCCCAGCATTTA None
GCATTTACCTCTATCACTTCGGCTAACCGCGACTCCGACCAATTCCTGGACCCCGATGAGTTTGATGTCGAACGTAATCCGAACGAACACATAGCATTTGGA None
GCAGGCGTTGATTCGCGCAACATCTTGGTTAGTGAGCCGCCGGGCTATCGCCTTCTCATTGGAGATCGACAGCAATGCGATCTCGACCGTTTCGTGGCAGCG None
TTCTCATTGGAGATCGACAGCAATGCGATCTCGACCGTTTCGTGGCAGCGAAAGAATCGGGACTGCGCGCTTCTGCCAAAGGATATTTTAGCGAGGCGATCC None
CGCGCCGACGTCGTTATCCCTAAATTGGAAAGACTCGTTGCGATGCATCCTTATCGCGAGTCGTTATGGAAGCAGTTAATGCTCGGCTACTACGTGAACGAA None
GCGAGTCGTTATGGAAGCAGTTAATGCTCGGCTACTACGTGAACGAATACCAGTCCGCGGCAATCGACGCATATCATAGACTCAAGTCCACGCTCGCAGAGG None
ACATTCGCAAGGAATTGATCTCCGGCGGCAGCACGACGAAACTCACAGCTCCCGTCCTTCCGCTTCGCTGCTCGATGCCACGCCGACCTCAATACGGCCAAC None
GCTCCCGTCCTTCCGCTTCGCTGCTCGATGCCACGCCGACCTCAATACGGCCAACGATTAACCGGCAAATGCCGAGATTAACAACAAATGCTGCGCTTATCA None
AATACGGCCAACGATTAACCGGCAAATGCCGAGATTAACAACAAATGCTGCGCTTATCAGGGGGTTAGACCAACATTCATACAATTCGCCGGGACGCGCAAT None
AAATGCTGCGCTTATCAGGGGGTTAGACCAACATTCATACAATTCGCCGGGACGCGCAATCCCCAGTTTTGCTTCGCAGCGACCGACGCCGGACCCAGCCAC None
CCAAACCCGGTGTTCCGGTCGCCCGAGTCGAAACCGCCCGTATTGATGCTGCCCGAGTTCGCGAATCCCGTATTGATACTGCCCGCGTTTGCGAAGCCCACG None
TGATGCTGCCCGAGTTCGCGAATCCCGTATTGATACTGCCCGCGTTTGCGAAGCCCACGTTTAGGGTGCCCGCGTTGCCAAAGCCCACACTTTGGTTGCCCG None
TTTGCGAAGCCCACGTTTAGGGTGCCCGCGTTGCCAAAGCCCACACTTTGGTTGCCCGCATTGCCAACGCCCACGTTAAAGGAACCGCCGTTCCCGACGCCC None
TGGTTGCCCGCATTGCCAACGCCCACGTTAAAGGAACCGCCGTTCCCGACGCCCATGTCTTCGTTGCCCGCGTTCCCGATGCCCATATTGAAGAAGCCGGCG None
CCGAGGTTTCCAAAGCCTCGGTTTCCGCTGCCCAGATTGACATTGCCAACGTTTCCGCTGCCGAGATTGGTGTTGCCGATATTTCCGCTGCCCAAATTCGTG None
TCCGCTGCCGAGATTGGTGTTGCCGATATTTCCGCTGCCCAAATTCGTGGCACCGTCATTTCCGCTGCCCACATTGGCGTTGCCGGAGTTTCCGCTACCTAC None
CCGTCATTTCCGCTGCCCACATTGGCGTTGCCGGAGTTTCCGCTACCTACGTTGGCGTTGCCGGAATTTCCGCTGCCCAGATTGTAGTCACCGGTGTTCCCG None
ACCGCGACAGAGAAACACCGACACACGACCGACACCGTCACCGAAAGGCCGCTTACCCTCGTATGACCGCAGTGAAACACACAACTGAATCAACATTTGCCA None
CCGCTTACCCTCGTATGACCGCAGTGAAACACACAACTGAATCAACATTTGCCAAACTTGGAGTCCGCGACGAAATAGTCCGCGCATTAGGGGAAGAGGGCA None
GCCGCCGATATTGCCGCCACCCACATTGAACCCACCGACGTTGCCCGCACCCAGGTTAAAGTCCCCGACATTGCCCAACCCGACATTGCCCAACCCCACATC None
AAATTCAGCACACCCGAATGCAGCGTGCCGGCGTTGAAAACACCCGAACCCCCACCCAGCAACGCCGACGGAGCCTGATTCCAGCCACCCGACACCATCGCG None
GCCGATATTGCCGCCACCCACATTGAACCCACCGACGTTGCCCGCACCCAGGTTAAAGTCCCCGACATTGCCCAACCCGACATTGCCGCCACCGAGGTTGCT None
CGATCGTGATGAACGGGTCCGGCAAGACGACCGGGTCCGCGGTGATTTCTGCCATGGCGGTTTGCCCGAAAAGAACAAACGCGGGATTCACGTGAAAACCCT None
ACGACCGGGTCCGCGGTGATTTCTGCCATGGCGGTTTGCCCGAAAAGAACAAACGCGGGATTCACGTGAAAACCCTCGAGGCCGACGGTTCCGGTCACGTGG None
CATGGCGGTTTGCCCGAAAAGAACAAACGCGGGATTCACGTGAAAACCCTCGAGGCCGACGGTTCCGGTCACGTGGATCGGGATCGCGGGAATGGTGATCTC None
GCCGACGGTTCCGGTCACGTGGATCGGGATCGCGGGAATGGTGATCTCCGGGAGAGTGAATTCGCGGATCCCGATGAATCCCCCGGTGATTTGTATGTCGAA None
AGATTGTCCCCGCTGAGCCCGATACCGATATTCCCGTTGCCGGTATTGGCCAACCCGATGTTGCCGATGCCCATGTTCGCCAGGCCGAAATTGCTGCTGCCG None
TTGGCCAACCCGATGTTGCCGATGCCCATGTTCGCCAGGCCGAAATTGCTGCTGCCGGCATTGCCGAACCCGACGTTGTCGAACCCGATATTGCCCAATCCG None
GCATTGCCGAACCCGACGTTGTCGAACCCGATATTGCCCAATCCGAAGTTGTTGCCGCCCAGCGCGCCGCCCGACAACATCCCCGACAACTGAGTACCTACA None
CGCCCGACAACATCCCCGACAACTGAGTACCTACATTGCCGATACCCGACATCAACGTGCCGGAGTTGAAATAGCCCGAAACCGTTCCCGGCAACACCTGCA None
GCCAGCAGCGCCAGTGGATTGTTGGGAATACTGATGCCATTCGGGAAGATCGTTACTGCCGGGGTACTCCAGTTGACGGTCACCGGGAATGACTGGTTAATT None
AGATCGTTACTGCCGGGGTACTCCAGTTGACGGTCACCGGGAATGACTGGTTAATTCTGGTGTCGATATTAAGGTTACCTAATTGGAGGGTGACGTTGCCGG None
GGTTAATTCTGGTGTCGATATTAAGGTTACCTAATTGGAGGGTGACGTTGCCGGCAAGATCTTTGATTTCGATTCCTGAAATGTTGACGACCCCCAAGCCAA None
TCAGGCCCCCAATGCCAGTCAGGTTGTCCCCGGTCAACCCGATCCCGATGTTGTTGCTACCCGTGTTGGCAAAACCGATGTTGCCCACACCCAGGTTTGCGA None
TTGCTACCCGTGTTGGCAAAACCGATGTTGCCCACACCCAGGTTTGCGAGGCCGTAGTTGCTGCTGCCCGCATTGCCCAACCCAATATTGCCCATGCCCGGC None
CGTTGTAATTACCGACATTGCCCAAGCCCGCGTTAAGCCTCAACATCTTCGCGGGTCCGGCAAATAGAGCATTGAGGAACGCGCCGACACCACCCCCCAACG None
AGCCCACCCGGGAAGAAGGTGAACCCGTCGTTGGCGACCTCCATACCCACCGTCACGGGGGTTTGCGCGGGAATGGTGAAACCATTCGGGAAAAGCGTCCAC None
ACCCGTCGTTGGCGACCTCCATACCCACCGTCACGGGGGTTTGCGCGGGAATGGTGAAACCATTCGGGAAAAGCGTCCACGGGGTGGTGTCCAAGTTGAGGG None
CGTCACGGGGGTTTGCGCGGGAATGGTGAAACCATTCGGGAAAAGCGTCCACGGGGTGGTGTCCAAGTTGAGGGTTAGGGGAATTGGTGTCGGGGTGACCAA None
GAAACCATTCGGGAAAAGCGTCCACGGGGTGGTGTCCAAGTTGAGGGTTAGGGGAATTGGTGTCGGGGTGACCAATATCTGACCGCTAACCGTGAGGCCGGG None
CGGTCCGATGGTCCCCGACCAGCCCGATCCCGATGTTGCCCGTGCCGGTGTTGGCAAACCCAATATTGCCCACACCCATGTTCGCCAAGCCATAGTTGTTGA None
GGCAAACCCAATATTGCCCACACCCATGTTCGCCAAGCCATAGTTGTTGATGCCGGCATTGCCAAAACCAACATTGCCCACCCCCGCCGCGCCGGCGGTCAG None
CCCGCCGCGCCGGCGGTCAGGCCCAAGTTGGCAAACCCCAGGTTGCCATGGCCGATGTTGCCCAACCCCAGGTTGCCGTCCCCGACATTGCCCAGGCCCAGG None
TCGACAACGGCAACGGCTGCGCGGGAACACTAAATCCCGGGATGGTAAAGCCCGGGTTACTGATCGACACACTCACCAGCAACCCCAAAGGATTATCGGGAG None
GCGCGGGAACACTAAATCCCGGGATGGTAAAGCCCGGGTTACTGATCGACACACTCACCAGCAACCCCAAAGGATTATCGGGAGCACTGATGCCATTCGGGA None
TGGTAAAGCCCGGGTTACTGATCGACACACTCACCAGCAACCCCAAAGGATTATCGGGAGCACTGATGCCATTCGGGAACAGCGTGATCGGAGGGGTATCCC None
GTTACTGATCGACACACTCACCAGCAACCCCAAAGGATTATCGGGAGCACTGATGCCATTCGGGAACAGCGTGATCGGAGGGGTATCCCATCTGATCGTTAA None
AACGATTCCCCGATAATCGCGGGTACTGGGTGCACTTTGCACAGACGCCGCAGCAAAATGCACATATGCCCTGTCCAGACCGGCGAGCGGCAGGGCGTCATC None
CGGCGTGCGCCGAACCGGCAGCGCCGGCAAATCCATGACCCCAGCCTGTTCTTGGGTCACTGCGACGTTCACTTTTAAGCGCGACCACGTAAGGTTGGGCAA None
TGATATGTTTATTGATTTTGCTTCCGCCGAGTTTTCTCAACTTCTGCTCACGCACTCCGACAAGCTCGCCGAGGATGGATTCCTCGTGGCAAATGGCAAGGC None
CGAGTTTTCTCAACTTCTGCTCACGCACTCCGACAAGCTCGCCGAGGATGGATTCCTCGTGGCAAATGGCAAGGCCAAGTCGCGCCGCCTCAGCCATCAGCG None
CACTCCGACAAGCTCGCCGAGGATGGATTCCTCGTGGCAAATGGCAAGGCCAAGTCGCGCCGCCTCAGCCATCAGCGTAGGTGCGATTAACTCAAACCCGAC None
ATCAGCTTTCCGGCCATAGAGCATCGTCACCGGGTTAGGCATGGTTTAGGCAGCGCTTAGCTGAGAACGCCGAGGCGTGTCGGCTCGCCGAGGCCCAAAACA None
AGGCCCAAAACAGCACAACCTTGCACTGATCTAGCTGAAGACCAAACCGGCACAGCAGACATTGCCATACGCGACAACAGCCGTCATCAACCGAAAGGAGCA None
AAACCGGCACAGCAGACATTGCCATACGCGACAACAGCCGTCATCAACCGAAAGGAGCAAAGAACAAACAGATGCATCCAATGATACCAGCGGAGTATATCT None
GGAAGGTGGTACCCCCGGAGGAGATCGCCGCCAACCGCGAGGAGAGGCGCAGGCTGATCGCGAGCAACGTGGCCGGGGTAAACACTCCAGCAATCGCAGACC None
GCGCAGGCTGATCGCGAGCAACGTGGCCGGGGTAAACACTCCAGCAATCGCAGACCTCGATGCACAATACGACCAGTACCGGGCCCGCAATGTCGCTGTAAT None
GCACAGCGACATTACCATACCTGACAACAGCCGTCACCAACCGAAAGGAGCAAAGAACAAGCAGATGCATCTAATGATACCCGCGGAGTATATCTCCAACGT None
AGTATATCTCCAACGTAATATATGAAGGTCCGCGTGCTGACTCATTGTATGCCGCCGACCAGCGATTGCGACAATTAGCTGACTCAGTTAGAACGACTGCCG None
GCCGACCAGCGATTGCGACAATTAGCTGACTCAGTTAGAACGACTGCCGAGTCGCTCAACACCACGCTCGACGAGCTGCACGAGAACTGGAAAGGTAGTTCA None
CTCAACACCACGCTCGACGAGCTGCACGAGAACTGGAAAGGTAGTTCATCGGAATGGATGGCCGACGCGGCTTTGCGGTATCTCGACTGGCTGTCTAAACAC None
CGAGGAGGTGCGCAGGCTGATCGCGAGCAACGTGGCCGGGGGTAAACACTCCAGCAATCGCAGACCTCGAGGCACAATACGAGCAGTACCGGGCCGAAAATA None
TCTTTGAGAGGGAGCGAAGTAGCCGTGTCTTTTATCTTCACAACCCCCCAGGCACTGGACAACGCGGCTAAGTCCGTGTCGGGGATTCACGATTTGTGGCGC None
GATCAGCTTTCCGGCCATAGAGCATCGTCACCGGGTTAGGCATGGTTTAGGCAGCGCTTAGCTGAGAACGCCGAGGCGTGTCGGCTCGCCGAGGCCCAAAAC None
CAAAACAGCACAACCTTGCACTGATCTAGCTGAAGACCAAACCGGCACAGCAGACATTGCCATACGCGACAACAGCCGTCATCAACCGAAAGGAGCAAAGAA None
GACTCATTGTCTGCCGCCGCCGAGCAATTGCGACTAATGTATAACTCAGCTAACATGACGGCTAAGTCGCTCACCGACAGGCTCGGCGAGCTGCAGGAGAAC None
GTGCACAGGCTGATCGCGAGCAACGTGGCCGGGGTAAACACTCCAGCAATCGCAGGACTCGATGCACAATATCAGCAGTACCGGGCCCAAAATATCGCTGTC None
GGGGCCGGCGTGCGTAATACGAGGACATTTTCAGCACGTTTCGCCGGAATGTGGCCGGTGGTTGGCGTTAGCTGCACGGAAGCGCCTGAGCTGGCCCGCCGT None
CTGCATTTAGGGGATCACAGGCACCTTGAAATGCATCGGTGTATGACTGGGAGTTTGCTGTACGTCTATTGGTAAGTGCGAATTCGCCGCCGGCTACCCGCA None
CACGTTCGCCAACGGACCACCCTGGCCCTGCAGCAACTCGATGACCGCACTGGTGATGGTGTTGATCTTGTCAGCGTCAAAGCCTTTCAGCACCGGCCGTAG None
GCAGCAACTCGATGACCGCACTGGTGATGGTGTTGATCTTGTCAGCGTCAAAGCCTTTCAGCACCGGCCGTAGCCCACCCAGCAACGCATCGAGATCCAGTG None
GGTGTTGATCTTGTCAGCGTCAAAGCCTTTCAGCACCGGCCGTAGCCCACCCAGCAACGCATCGAGATCCAGTGCGGGCTGGGTGTGGGCCACGTTGATGGT None
CCCATTGCCAGATGTCTGGTATATCGCGCCACGGCTTGTCATGATCCGGGTGCTTTTTATCGAGTTTTTGAAAGAGATCTCTATAAGCCTTGTTAAGTTTGC None
TTATCGAGTTTTTGAAAGAGATCTCTATAAGCCTTGTTAAGTTTGCTGTGCGGGACGTTACGAAAGTAGTGCTTTTCACCCAGATCCAACAATCTAACTGTG None
CGGCAATCTCCTGGTCTCCGAAGTTCCCCTCAATAACGCGAAGTTGCGGATATGAATTTGCACGGGCCGCGACTGTTGGAGTTATGCGGCCATCGACCAATA None
CTCACCCGATTCGGCGTCGAAGCGGGGCGCTCTCATGGTTGCGAGGCAAAGCAAATCTCGGTTGTCCTAAATCGCGTCCGCTAAACACCTAGCTAGGCCGAT None
CTGAATCTGATAACGCCGATATCCACTCGGGAGTTATCGGGCAACGGAAAGCGAAACGGCCTCCGTCGGAGAGCGACTGGGATAGCCCTGGTTCCGGGTGGT None
TCCGTCGGAGAGCGACTGGGATAGCCCTGGTTCCGGGTGGTTTGCTATCCCGGGATAACGGCAGTGCTACATGCTCGGACCGATTTGCGATGCAGCCCCACC None
TTGGTTGACCTGCTGCTTTTGTCCGCGAATTCACCGGAATTTGAACTGGACCTGGCCGGCAATCGTGGGGCAGTCACTGTGAGCTGTAGCCATGCCAGCTGC None
CTATGCTGGGTCGGTGACCGTCTCCGACTCGCCCGCCCAGCGGCAAACCCCACCGCAAACACCGGGAGGCACCGCTCCGCGAGCCCGCACCGCGGCCTTTTT None
AGGCACCGCTCCGCGAGCCCGCACCGCGGCCTTTTTCGACCTGGACAAGACCATCATTGCCAAGTCCAGCACACTGGCGTTCAGCAAACCTTTCTTCGCTCA None
GCGGCCTTTTTCGACCTGGACAAGACCATCATTGCCAAGTCCAGCACACTGGCGTTCAGCAAACCTTTCTTCGCTCAGGGACTGCTCAACCGCCGCGCCGTG None
TGCGGGCCACACAGTGGCCCGAGGAGGAACGGGGCCACGAAGCAGGCCGCCGGATCGCGCCCGAGCGGGCGGGCAGCAAACGTCTAGCCCACGCAATCCAAA None
GCGCCCGAGCGGGCGGGCAGCAAACGTCTAGCCCACGCAATCCAAAGCCGCTTCGTAACTTTCGCAGAATTGGGCCTTGCTGTGTTAAAGGTCTAGTAGTAC None
TGGTCAGTGCGTGGCATTACTTTCCCCGGCACCGATTTCTGTTCGGCGACAAGTACGACTCGGTGATGATCGACCAGAAAGATCTCGACGCCATGGCATACC None
AGTACGACTCGGTGATGATCGACCAGAAAGATCTCGACGCCATGGCATACCTGGCGAGTTTGCCCGGCGCACGCGACACGTTGATTGGCAACGCCAACACGG None
ACCTGGCGAGTTTGCCCGGCGCACGCGACACGTTGATTGGCAACGCCAACACGGACGGCACCGCGTGGATGTATGCCGTGGCCGGCCTACACCCGCTGTGGA None
ACGCCGTGCCCTCGGACGCCGAGTTGCGCATTGCCCAGGCACAGCTGGTCGGCTGGCTGGAAGGGCTGTTCCACGGCATCCAAACCGCGCTATTTGCTCAGC None
CTGGCTGGAAGGGCTGTTCCACGGCATCCAAACCGCGCTATTTGCTCAGCAAATGGCGGCGCGCGCGCAGCTGCAACAAATGCGCCAGGGTGCGCTGCCGCC None
CTGGCAGCAGATCGCCGCGGCGCTCGCCAACGCCGTCCAGAACTTCCCCGCCCTGGTGGCGAATTTGCCAGCGGCCATCGACGCGGCCGTCCAGCAATTCCT None
CTGGTGGCGAATTTGCCAGCGGCCATCGACGCGGCCGTCCAGCAATTCCTGGCCTTCAACGCGGCGTACTACATCCAACAGATTATTAGCTCGCAGATCGGC None
CAACAGATTATTAGCTCGCAGATCGGCTTCGCCCAGCTATTCGCCACGACGGTCGGTCAGGGGGTCACCAGCGTCATTGCCGGGTGGCCCAACCTTGCGGCG None
TAACGCAGAGCTCTCACATGAAATGTCCAGGCGTCTCCGACTGCGTTGCGACCGTAAGGCACGATAACGTGTTTGCTATTGCTGCTGGTTTGCGTTGGTCGG None
AAATGTCCAGGCGTCTCCGACTGCGTTGCGACCGTAAGGCACGATAACGTGTTTGCTATTGCTGCTGGTTTGCGTTGGTCGGCCGCTGTACCGCCGCTACAC None
CTGCCGCCACGGCAGCAGCAACAAATGCGCTCCGCGGGGCCAACGTGGGCCCGGGCGCCAACAAGGCGTTGTCGATGGTCCGGGGTTTGCTACCCAAAGGGA None
GGGGCCAACGTGGGCCCGGGCGCCAACAAGGCGTTGTCGATGGTCCGGGGTTTGCTACCCAAAGGGAAGAAGCACTAGCCATAAAGTCCACGACCTACGGTG None
ACCCAAAGGGAAGAAGCACTAGCCATAAAGTCCACGACCTACGGTGGCGTTTCGCAGTTGGGGGTGTAAAGGGGGTTGAGGTCTTCGACGATGGCGGTTGCT None
CCTACGGTGGCGTTTCGCAGTTGGGGGTGTAAAGGGGGTTGAGGTCTTCGACGATGGCGGTTGCTGCTGGCCCACCAATCCGTTGCTGCTGACGCCAATCCA None
AACACGATAACGCCAATACCGAGCGCCGCCAGGTACGATACGATAACCGAGCCGATCAGATACAGCGGTGCCACAATCGCACGCAGCAAAACGATCAATATG None
ACGATACGATAACCGAGCCGATCAGATACAGCGGTGCCACAATCGCACGCAGCAAAACGATCAATATGAGCAGAACGATGCAGACGGTCATGGCGATGATCA None
ACATCGGACCAACCGTTTTGAGAATTCCCAGTTGGGTAAACACCATCCCGAGAAAGGTGATTGCTACGGTAGCCGCGGAGGCGGCGATCACCTTACCGATGG None
AGGCCCGCCAAGCCGGCTATTGCAACGAGGCGCTGTGCAACCACCACGGACATGCCAATTGTTATCAATGGCAACACCATGGTGATCGGATTCCCGTAGATG None
TTGTTATCAATGGCAACACCATGGTGATCGGATTCCCGTAGATGATCAGCAAAATGACCAACAACAGGATCGTGATCGCAAACTCGATGCGACTGCGGTCCC None
CGCAACCTTTAGATTGCAGATATCGATAAAATCACCCGCGCGACAAGACCGCCATGTCATCCTTTCGATGTTATTTCGCCGGCCTGGGGAAAGCGCAACGAC None
CCATGTCATCCTTTCGATGTTATTTCGCCGGCCTGGGGAAAGCGCAACGACGTTGCCTACACGTTCCGCCGTCCCACCGTTGGCAATGCGCATACACACCGA None
CGTTGCCTACACGTTCCGCCGTCCCACCGTTGGCAATGCGCATACACACCGATCTAATTGCCCTCAGATATGCGGTAACGGATTCGCGAGCGACCGGATTAT None
TCTAATTGCCCTCAGATATGCGGTAACGGATTCGCGAGCGACCGGATTATCTGGGAATAGCACGCTCGCCGCGGTCTCGTCGAAACGACCGACCATCGTACT None
ACCAATGAAACGAGCGTTCGCCGCCATGCAGGCGGATTCGAATCGCTGTGTTTGCTGCTCGTCCATTAGCATCATGCTGAGCAGGTCGCCGCCGCAGCGTAC None
CGGACGGCACGGCATTCACTTACATCGATTACGAACGGGATTCGGAGGGCATAAGTGAAAGCCTGACGTGGTCGCAGGTGTATCGGCGAACCCTAAACGTTG None
AAGTGAAAGCCTGACGTGGTCGCAGGTGTATCGGCGAACCCTAAACGTTGCAGCAGAAGTCCGCCGCCATGCCGCAATTGGTGACCGTGCAGTGATATTGGC None
GTTGCAGCAGAAGTCCGCCGCCATGCCGCAATTGGTGACCGTGCAGTGATATTGGCCCCACAAGGACTCGATTATATTGTTGCTTTTCTGGGCGCTTTACAG None
CAACCGCATATTTGCAGTATACGTCGGGATCGACCCGCACACCTGCCGGTGTAATGATTACCTACAAGAATATATTGGCAAATTTCCAGCAGATGATTTCCG None
TTCCAGCAGATGATTTCCGCCTATTTCGCCGACACCGGAGCCGTACCGCCATTGGACCTTTTCATTATGTCGTGGCTACCGTTCTATCATGACATGGGTTTG None
CAGGCGTTTTCGGCGGCACCGAACTTCGCCTTCGAACTGACGGCAGCAAAAGCAATAGATGACGACTTGGCCGGGCTCGACCTTGGACGGATCAAAACCATC None
CGCCTGACGAGCGCTGTGCGGACCCAGGCAGCAAAGGAGGCTCTCGGCGAATCTCCGTTGGCTGCTGGTTGCCCGGAGTCGGCCGCATCCGCCCGACACGGT None
GGACCCTCATCGGGGGGGTCTTCGTTGACCCCTCACAACGTCAGCACCCAATCCGCTCAGGTTTGCACTTGGTTGTGGACACAACTGTCGCTACCATGATCA None
ACGTCAGCACCCAATCCGCTCAGGTTTGCACTTGGTTGTGGACACAACTGTCGCTACCATGATCAGCAAATACATACAGATAACCGTTTGCTCTTGGAGCCC None
GGCACAGTTCATCGCTTCACTGAGTTTAGTTGGGACCTAGGCCCAGATGCCGTCGCGGCCTGGGGCGCCATTGCCCTAGATAACAATCTGATAAAGCGGAGC None
GTCGCGGCCTGGGGCGCCATTGCCCTAGATAACAATCTGATAAAGCGGAGCAAACAAGCTGTGGTGCACACTCGGGCACGTATCAGGTTGGCTACACAGCGA None
CCACATCGACTCATTAGACACCTCGGAGCTGGCAAACAGTGAACGGCGCGCCGAGCAATTATCAAATGTTTCTGATGTGACTCTAGTGATTATTGAAGCGGT None
CAGGCGCTGTCCTCGCAAATGGGCTTCTGACCCGCTAATACGAAAAGAAACGGAGCAAAAACATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAGGCCG None
CAAAAACATGACAGAGCAGCAGTGGAATTTCGCGGGTATCGAGGCCGCGGCAAGCGCAATCCAGGGAAATGTCACGTCCATTCATTCCCTCCTTGACGAGGG None
GCGGCCTGGGGCGGTAGCGGTTCGGAGGCGTACCAGGGTGTCCAGCAAAAATGGGACGCCACGGCTACCGAGCTGAACAACGCGCTGCAGAACCTGGCGCGG None
CTGGCGCGGACGATCAGCGAAGCCGGTCAGGCAATGGCTTCGACCGAAGGCAACGTCACTGGGATGTTCGCATAGGGCAACGCCGAGTTCGCGTAGAATAGC None
GGTGTGCCCGGGGATGGCACGACCAGGGTAGGCACGTCTGGGGGTGGCGGCGACTTCTGCTGAAGCAAATCCTCGAGTGCGTTCTTCGGAGGTTTCCAATTC None
GTGGCGGCGACTTCTGCTGAAGCAAATCCTCGAGTGCGTTCTTCGGAGGTTTCCAATTCTTGGATTCCAGCACCCGCTCAGCGGTCTCGGCGACCAGACTGA None
GTTTCCAATTCTTGGATTCCAGCACCCGCTCAGCGGTCTCGGCGACCAGACTGACATTGGCCCCATGCGTCGCCGTGACCAATGAATTGATGGCGGTATGGC None
TGATCTTGTGTAGCTCATAGCTACCCGCCGGCAGCGCAACCCCGTCGAAACCTTTGCGCTTCAGATCGGCATCGAACAACTCCACCATTCCTTCGAAGAATC None
ATCGGCATCGAACAACTCCACCATTCCTTCGAAGAATCCCTCTACTGGAATTCCGGCGGGGAATACCTGGGAGCATAGATGCTTGTCGTAGCAAATGTTGAC None
ACTGGAATTCCGGCGGGGAATACCTGGGAGCATAGATGCTTGTCGTAGCAAATGTTGACCGCACAACGTGCCGGGAAAGCAACCTTATGCGGCGCAGTCACT None
CACGACCGCGATGCTAACATGATTCGAGATTCCTTGTTTACTGCGCGTGAGCGGCTCTTTGAGTGCATTAGTTTGCTATTCGCCAGACAATGTCATTCACAC None
GTGAGCGGCTCTTTGAGTGCATTAGTTTGCTATTCGCCAGACAATGTCATTCACACCACACGCCGGTATGAGTACCATTCGTCACCAGCGGGCAAGCGGCGG None
GACAGCATCTGCGCCTGGGCGTCGAAAAACCCTTGCGCGCCGTGGCCCGCGAAAAACTCTTGCAGCGCATTTGTTTTGCTGGCGGTGTCTTCGTAAATCATG None
CGAAAAACCCTTGCGCGCCGTGGCCCGCGAAAAACTCTTGCAGCGCATTTGTTTTGCTGGCGGTGTCTTCGTAAATCATGTGGAGCTGGCCGGCGCGCGAGC None
GCGAAAAACTCTTGCAGCGCATTTGTTTTGCTGGCGGTGTCTTCGTAAATCATGTGGAGCTGGCCGGCGCGCGAGCCCACGTCGGAAGCGAAGTCGGATACG None
GTTTTGCTGGCGGTGTCTTCGTAAATCATGTGGAGCTGGCCGGCGCGCGAGCCCACGTCGGAAGCGAAGTCGGATACGGCTCCCGGGTTATACGTGATTTGA None
CAGGTGGCGGGGTTCATGACGTTTTCCTGGTTGGCTAGGTAGCCCTTGGCGATTCCCATGGCTTGCTCCATATTCGCCTGGATATCGTTGGCGGTGCTGCGC None
TGACGTTTTCCTGGTTGGCTAGGTAGCCCTTGGCGATTCCCATGGCTTGCTCCATATTCGCCTGGATATCGTTGGCGGTGCTGCGCAGCATCTGCGGTGTTA None
TTGCTCCATATTCGCCTGGATATCGTTGGCGGTGCTGCGCAGCATCTGCGGTGTTACCTGAATTGTGTCTGCCACGGGCCCTTCTCCTTTACTGCCGTTAGC None
TTGGCGGTGCTGCGCAGCATCTGCGGTGTTACCTGAATTGTGTCTGCCACGGGCCCTTCTCCTTTACTGCCGTTAGCCGTTCCCCCTCAAATATCGGGGCAT None
TACCTGAATTGTGTCTGCCACGGGCCCTTCTCCTTTACTGCCGTTAGCCGTTCCCCCTCAAATATCGGGGCATGACGCGAAGTGTATGGCTGCTCTGCGGAC None
ACAATTCAACCAGTCGATCAGCCGCGGTAATTGCAACAACCGTTCCACTGGAATCGATAAGGGTATCCCGTTGCCGACCGGCAAACGTCATCGTCCCGATGC None
CGGTAATTGCAACAACCGTTCCACTGGAATCGATAAGGGTATCCCGTTGCCGACCGGCAAACGTCATCGTCCCGATGCTATATTCCGGCATCAGCTCTTCGG None
AATCGATAAGGGTATCCCGTTGCCGACCGGCAAACGTCATCGTCCCGATGCTATATTCCGGCATCAGCTCTTCGGGCTGAAAAGGTGCCCGGATCGCCGGCA None

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
CCAGCAAAC
... ... Rv2864c relF relG
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAC
... ... Rv1289
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAC
... ... Rv0308 Rv0307c Rv0309
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAC
... ... Rv0308 Rv0307c Rv0309
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAC
... ... Rv0026 Rv0027 Rv0028
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAT
... ... pks1 lppX
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAT
... ... pks1 lppX
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAT
... ... gpsI pepR Rv2781c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAT
... ... gpsI pepR Rv2781c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAT
... ... vapC1
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAT
... ... vapC1
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAC
... ... Rv3902c Rv3901c Rv3900c Rv3899c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAC
... ... Rv3902c Rv3901c Rv3900c Rv3899c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAC
... ... Rv3902c Rv3901c Rv3900c Rv3899c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCAGCAAAC
... ... papA1 mmpL8
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCAGCAAAC
... ... MTS2823
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCAGCAAAC
... ... MTS2823
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAC
... ... Rv3661 B11 MTS2823
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAC
... ... Rv3661 B11 MTS2823
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAC
... ... moeB2 cysA3 sseC1 moaE1 Rv3120
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAC
... ... moeB2 cysA3 sseC1 moaE1 Rv3120
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAC
... ... Rv2956 Rv2955c Rv2957
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAC
... ... Rv2956 Rv2955c Rv2957
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAC
... ... Rv2665 Rv2666 clpC2 Rv2668 Rv2669
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCAGCAAAC
... ... bioB Rv1588c Rv1587c Rv1586c Rv1585c Rv1584c Rv1583c Rv1582c Rv1590 Rv1591
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCAGCAAAC
... ... bioB Rv1588c Rv1587c Rv1586c Rv1585c Rv1584c Rv1583c Rv1582c Rv1590 Rv1591
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAC
... ... PPE5
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAC
... ... PPE5
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCAGCAAAC
... ... Rv0010c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCAGCAAAC
... ... Rv0010c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAT
... ... espR Rv3850 Rv3851 hns rraA
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAT
... ... Rv3780 rfbE glfT1 rfbD
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAC
... ... Rv3528c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAC
... ... lipF Rv3488 Rv3489 otsA
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAT
... ... moaA1 moaB1 moaC1 moaD1 Rv3113 Rv3114
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAC
... ... lipY
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAT
... ... fadD26 ppsA ppsB ppsC ppsD ppsE drrA drrB drrC papA5
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTAGCAAAC
... ... Rv2665 Rv2666 clpC2 Rv2668 Rv2669
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAG
... ... Rv2307c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAG
... ... Rv2307c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAG
... ... Rv2307c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAG
... ... ctaE trpD qcrC qcrA qcrB
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAC
... ... Rv2137c Rv2136c Rv2135c Rv2134c Rv2133c lppL
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAC
... ... Rv2137c Rv2136c Rv2135c Rv2134c Rv2133c lppL
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAC
... ... Rv2137c Rv2136c Rv2135c Rv2134c Rv2133c lppL
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAT
... ... Rv2082 Rv2081c Rv2083 Rv2084 Rv2085 Rv2086 Rv2087
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAT
... ... Rv2082 Rv2081c Rv2083 Rv2084 Rv2085 Rv2086 Rv2087
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAT
... ... Rv1496 lipL
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAT
... ... Rv1496 lipL
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCAGCAAAT
... ... Rv1356c moeY Rv1354c Rv1353c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAT
... ... PPE1 Rv0095c Rv0094c Rv0093c Rv0097 fcoT fadD10 Rv0100 nrp
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAG
... ... Rv0025 Rv0026 Rv0027 Rv0028
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAG
... ... trpG
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAG
... ... trpG
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTAGCAAAT
... ... PPE15 esxJ esxI Rv1036c Rv1035c Rv1034c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTAGCAAAT
... ... PPE15 esxJ esxI Rv1036c Rv1035c Rv1034c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTAGCAAAT
... ... PPE15 esxJ esxI Rv1036c Rv1035c Rv1034c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAT
... ... Rv0845 narL
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAT
... ... Rv0845 narL
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAT
... ... fadB2 umaA
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAT
... ... fadB2 umaA
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAT
... ... aspC
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ACAGCAAAT
... ... aspC
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCGGCAAAC
... ... Rv3661 B11 MTS2823
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCGGCAAAC
... ... esxS esxR
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCGGCAAAC
... ... mmpL9 moeW Rv2337c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCGGCAAAC
... ... mmpL9 moeW Rv2337c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCGGCAAAC
... ... wag31 Rv2144c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCGGCAAAC
... ... lipL
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCGGCAAAC
... ... pks6
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCGGCAAAC
... ... pks6
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCGGCAAAC
... ... Rv0386
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCGGCAAAC
... ... mmpL11 Rv0201c Rv0203
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCGGCAAAC
... ... mmpL11 Rv0201c Rv0203
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCGGCAAAC
... ... mmpL11 Rv0201c Rv0203
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAC
... ... Rv3857c Rv3856c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GCAGCAAAG
... ... Rv3848 espR Rv3850 Rv3851 hns rraA
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GTAGCAAAC
... ... Rv3822
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GTAGCAAAC
... ... Rv3822
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAC
... ... drrC papA5
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAC
... ... drrC papA5
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TTAGCAAAC
... ... Rv2665 Rv2666 clpC2 Rv2668 Rv2669
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAC
... ... Rv2307A Rv2307c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAC
... ... Rv2307A Rv2307c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAG
... ... Rv2082 Rv2081c Rv2083 Rv2084 Rv2085 Rv2086 Rv2087
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCGGCAAAT
... ... cydA cydB cydD cydC
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCGGCAAAT
... ... cydA cydB cydD cydC
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCGGCAAAT
... ... cydA cydB cydD cydC
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAG
... ... Rv1501 Rv1502
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCGGCAAAG
... ... Rv1490
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GTAGCAAAC
... ... Rv1364c mcr15 Rv1363c Rv1362c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GTAGCAAAC
... ... Rv1364c mcr15 Rv1363c Rv1362c
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
TCAGCAAAG
... ... Rv0986 mscL Rv0987 Rv0988
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAC
... ... Rv0876c Rv0875c Rv0874c Rv0877
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAC
... ... Rv0876c Rv0875c Rv0874c Rv0877
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAC
... ... senX3 regX3
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAC
... ... fadB2 umaA
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAA
... ... esxC espG2 Rv3888c eccD2 mycP2 eccE2 eccA2
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAA
... ... esxC espG2 Rv3888c eccD2 mycP2 eccE2 eccA2
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAA
... ... esxC espG2 Rv3888c eccD2 mycP2 eccE2 eccA2
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAA
... ... esxC espG2 Rv3888c eccD2 mycP2 eccE2 eccA2
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ATAGCAAAC
... ... Rv3888c eccD2 mycP2 eccE2 eccA2
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ATAGCAAAC
... ... Rv3888c eccD2 mycP2 eccE2 eccA2
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GTAGCAAAT
... ... eccD2 mycP2 eccE2 eccA2
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
GTAGCAAAT
... ... eccD2 mycP2 eccE2 eccA2
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CCAGCAAAA
... ... esxA espI eccD1
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ATAGCAAAC
... ... Rv3822
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
ATAGCAAAC
... ... Rv3822
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAT
... ... Rv2949c fadD22 pks15 pks1
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details Motif-discovery (ECO:0005558) - not specified dimer
CTGGCAAAT
... ... tesA Rv2927c Rv2926c rnc Rv2929
Experimental technique details ChIP-Seq (ECO:0006009)