Curation Information

Publication: A mutational analysis defines Vibrio fischeri LuxR binding sites.;Antunes LC, Ferreira RB, Lostroh CP, Greenberg EP;Journal of bacteriology 2008 Jul; 190(13):4392-7 [18083819]
TF: LuxR [P35327, view regulon]
Reported TF sp.: Vibrio fischeri ES114
Reported site sp.: Vibrio fischeri ES114
Created by: Dinara Sagitova
Curation notes: -

Experimental Process

Site-directed mutagenesis identified bases critical for LuxR binding. The authors proposed a minimal sequence defining a lux box. This lux box was used to search nine LuxR-activated promoters for a lux box. GFP promoter fusion assays were performed with promoters containing a wild-type and promoters which lacked either part or the entire putative lux box. The results of these assays confirmed that LuxR-dependent activation required the presence of a full lux box.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

AACTGTAAAATCGGACAGGT
ACCTGTAAAATCTATCAGTT
TCCTGTAGTTTATTGCGGCT
AAGTGTATATATTTACAGTT
ACCTGTAATAAACGACAGGA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Experimental techniques	TF function	TF type
AACTGTAAAATCGGACAGGT	VF_1161,	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	not specified
ACCTGTAAAATCTATCAGTT	VF_1725	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	not specified
TCCTGTAGTTTATTGCGGCT	VF_1978,	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	not specified
AAGTGTATATATTTACAGTT	VF_A0090	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	not specified
ACCTGTAATAAACGACAGGA	qsrP,	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GFP Promoter Fusion (ECO:0005636) GFP Promoter Fusion - ECO:0005636 Target promoter is inserted in front of a GFP gene, and the target TF is induced. Expression levels of GFP should thereby depend on the target TF. - Experimental technique details Site directed mutagenesis (ECO:0005667) Site directed mutagenesis - ECO:0005667 Target-specific mutation, as opposed to non-specific mutation. In the context of TF-binding sites, site-directed mutagenesis is typically used to establish/confirm the specific sequence and location of a site, often in tandem with EMSA. Different positions of a putative binding site are mutated to non-consensus (or random) bases and binding to the mutated site is evaluated through EMSA or other means. Often implemented only in conserved motif positions or serially through all positions of a site. -	activator	not specified