In vitro transcription assay of the Pseudomonas putida catBCA promoter demonstrated dependence on both catR and the inducer molecule. DNase I protection in inducer-variable solution identified two catR binding sites, the recognition binding site (RBS) and activation binding site (ABS). The latter was confirmed by methylation interference assay. ABS was only bound in the presence of the inducer, while RBS was found to be inducer-independent.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TCCATCAGACCTCCAGGGTATGGTGGGAGATTCATTTGATATTGG | catB, catC, catA, |
|
activator | tetramer |