Curation Information

Publication: In vivo UV laser footprinting of the Pseudomonas putidasigma 54Pu promoter reveals that integration host factor couples transcriptional activity to growth phase.;Valls M, Buckle M, de Lorenzo V;The Journal of biological chemistry 2002 Jan 18; 277(3):2169-75 [11694511]
TF: IHF [P0A126, view regulon]
Reported TF sp.: Pseudomonas putida MAD2
Reported site sp.: Pseudomonas putida
Created by: Matthew Coveyou
Curation notes: -

Experimental Process

The Pseudomonas putida MAD2 strain is derived from P. putida KT2442 and contains a Pu-lacZ fusion and constitutive, inducer-independent xylR variant, allowing experimental focus on the Pu promoter’s IHF dependence. Beta-gal assay of ihfA-variable strains against a growth curve indicated near-total loss of Pu activity in the IHF-mutant strain in every growth phase, while IHF+ strains showed restricted activity in the exponential phase and sharply increased activity in stationary phase. Western blots of the IHF+ strains across the growth phases revealed an approximately seven-fold increase in IHF levels in stationary phase over exponential phase, suggesting Pu dependence on IHF concentration. In vitro IHF binding was visualized by UV footprinting and compared to footprints of rpoN and xylR controls, which indicated IHF binding is independent of both. In vivo UV footprinting of exponential vs. stationary phase ihfA-variable strains correlated to in vitro footprints, and demonstrated IHF binding occurred only in stationary phase.

The paper reports that TF forms complex with other proteins for binding with reported sites.

Transcription Factor Binding Sites

Sites reported in the paper
Sites matched in the genome

TTTTTTACAAAGAAAATCAATAATTTA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence	Regulated genes	Gene diagram	Experimental techniques	TF function	TF type
TTTTTTACAAAGAAAATCAATAATTTA	xylA, xylM, xylC, xylW, xylU,		Experimental technique details Beta-gal reporter assay Beta-gal reporter assay Reporter assay using the beta-galactosidase (lacZ) gene. The lacZ gene is typically fused to the promoter of interest. Differential regulation of the promoter mediated by the TF is assessed by induction of the system and evaluation of lacZ expression. Bacteria expressing lacZ appear blue when grown on a X-gal medium. The assay is often performed using a plasmid borne construction on a lacZ(def) strain. - Experimental technique details UV footprinting UV footprinting While DNase is by far the most commonly used tool for fragmenting DNA, it is not the only one. DNA footprinting can also be performed using other methods that cause non-specific breaks in the DNA, such as hydroxyl radicals, or UV radiation. There is little difference between these alternate methods of DNA cleavage and the more common DNase-mediated procedure aside from variant resolving power (hydroxyl radicals have a higher resolution) and small procedural changes. The data looks very similar, and is analyzed the same way. -	activator	dimer