Curation Information

Publication
ChIP-Seq and RNA-Seq Reveal an AmrZ-Mediated Mechanism for Cyclic di-GMP Synthesis and Biofilm Development by Pseudomonas aeruginosa.;Jones CJ, Newsom D, Kelly B, Irie Y, Jennings LK, Xu B, Limoli DH, Harrison JJ, Parsek MR, White P, Wozniak DJ;PLoS pathogens 2014 Mar; 10(3):e1003984 [24603766]
TF
AmrZ [G3XCY4, view regulon]
Reported TF sp.
Pseudomonas aeruginosa PAO1
Reported site sp.
Pseudomonas aeruginosa PAO1
Created by
Erill Lab
Curation notes
-

Experimental Process

ChIP-seq was performed comparing read enrichment in cross-linked (ChIP) experiments and non-cross-linked controls. ChIP-seq results were validated using previous literature on AmrZ binding and, for PA4843, using EMSA. RNA-seq was then performed using growth conditions similar to those of ChIP-seq on a AmrZ mutant and a complemented strain.

ChIP assay conditions
Strains were grown at 37uC on LANS (LBNS with 1.5% agar) or Pseudomonas Isolation Agar (Difco, Detroit, MI) agar plates. Cultures were induced with 0.5% arabinose at an OD600 of 0.1 and allowed to grow for two hours at 37uC in a roller.
ChIP notes
Protein-DNA complexes were cross-linked by addition of formaldehyde- to a final concentration of 1.0% and incubated at room temperature for ten minutes. Cross-linking was quenched by addition of glycine (final concentration 250 mM). The final OD600 was recorded and cells were collected from 1 OD600 of culture via centrifugation and washed once in LBNS. The supernatant was removed and pellets were stored for further processing at -80uC. Cell pellets were resuspended in 1.0 mL of lysis buffer (20 mM HEPES, pH 7.9; 50 mM KCl; 0.5 mM DTT; 500 mM NaCl; 10 mM imidazole; 1% BSA; 1 mg/mL leupeptin/pepstatin; and 400 mM PMSF) per 1 OD600 of culture. Samples were sonicated on Covaris with the following conditions: Duty Cycle 20%, Intensity 8, Cycles per burst 200, with frequency sweeping 20 min total shearing time (60 sec cycles, 20 cycles). Lysate was cleared via centrifugation (20,0006 g, 30 minutes, 4uC) and the supernatant was transferred to a fresh tube as the input sample. Magne-HIS beads (Promega V8560) were blocked at room temperature in lysis buffer for 30 minutes, and then 500 ml of the input sample was added to the beads. After 30 minutes of binding at room temperature with agitation, the supernatant was removed from the beads via magnetic separation. Beads were washed five times in wash buffer (100 mM HEPES, pH 7.5, 10 mM imidazole, 500 mM NaCl, and 1% BSA). Elution buffer (100 mM HEPES, pH 7.5; and 500 mM imidazole) was added to the beads and incubated at room temperature for 30 minutes. Supernatant was collected after magnetic separation and combined with SDS (1.25% final concentration), then heated to 70uC for 30 minutes to reverse cross-links. DNA was purified via phenol:chloroform extraction and ethanol precipitation. The chip DNA was quantified with Qubit 2 flurometer (Life Technologies) using Qubit dsDNA BR Assay. 10 ng of DNA was used to construct each Chip sequencing library, following NEXTflex ChIP-Seq kit (Bioo Scientific) instruction. NEXTflex ChIP-Seq Barcodes (Bioo Scientific) were used to index the library. The final DNA libraries were validated with Agilent 2100 Bioanalyzer using Agilent High Sensitivity DNA Kit. And the library concentrations were determined by Q-PCR using KAPA SYBR Fast qPCR kit. The libraries were then run on Single End flowcell on HiSeq200. HiSeq2000 sequencing was performed, resulting in approxmately 255 million total single-end 52 bp reads from the six control and eight treatment samples. Reads were aligned using bwa (0.5.10) to the Pseudomonas aeruginosa PAO1 reference genome. Approximately 220 million reads aligned uniquely to the reference (86.3%). A TDF file was created for each sample for visualization in IGV, which was scaled to reads per 10 million data using bedtools (2.17.0) and igvtools (2.3.3). ChIP-Seq analysis was performed using HOMER (4.2). First, aligned data was transformed into a platform-independent data structure for further HOMER analyses using the makeTagDirectory function. Secondly, HOMER’s findPeaks-style factor was utilized to identify peaks, or regions of the genome where more reads are present than random. Lastly, HOMER’s findMotifsGenome.pl was used to analyze genomic positions for de novo enriched motif regions of length 50 or 200 and identified peaks were annotated with the motifs using the annotatePeaks.pl function.

Transcription Factor Binding Sites


CCTATCGCCATGA
CTCTATGCTATCA
CATAGAGCCATCA
CAAGGCGCCATTA
CGCCTTGCCATTA
CAGAACGCCACCT
CCTTTTGCCAGCA
CGCTTGGCCACCA
CGGATTGGTATCA
CAGGCTGCCATCC
CAGATCGATATCG
CAGAAGGCCAGCC
CAACTAGCTATCA
CTAGTTGCCGGCA
CACAAAGCCATGA
TATTTCGCCATTA
CTGCTCGCCATCA
TCATTCGCCATCA
CCGTTCGCCATCC
CCGATCGCCAGTA
CAAATCGCCAGCG
CATATTGCCATTA
CAATATGCCAACG
CAGCTTGCCAATA
CAAGCTGCTATCA
TCCAGCGCCATCA
CGAAATGCCATTA
CATTTCGCTATGA
CAAAGCGCTATCA
CATTATGCTATCG
CAGGTTGCCATCA
CAGTGTGCCAGCG
CACAGTGCCATTA
CATCTGGCTATCA
CAAAACGCCATCA
CAGCTCGCCGCCG
CAAAAGGCCATTA
CCTTTTGTCATCA
CAGTGGGCCACCA
CAATGCGCCAGCA
TCAATGGCCATCA
GAACTTGCCATCG
CAGTTTCCCATCG
CAAATAGCCATTA
CGAATCGCGATCC
CACAGTGCTATCA
CGAAAGGCCACTA
CACAATGACATCA
CAGTTCGCCGCCA
ACGATCGCCATCA
CTGGTCGCCACCA
CTGTTCGCCAGCT
CAGGTGGCCACGA
CCCTTCGCTACCA
CGGATCGCCTCCA
CAGCATGCCATCG
CAGTACGGCATCC
CTATTCGGCAGCA
CGAATGGCCGGCA
CAAATAGCCATCA
CACTTTGCTATCA
CAATTGGCCATAC
CAGTCTGCCGTCA
CAGACTGCAACCA
CAGAAGGCCAACG
CACAATGCCACCC
GAGGTTGCCACCA
CAGCACGCCATCG
CGCTGTGCCATCA
CTTTCCGCCATCA
ACGATGGCCAGCA
CAGAGTGCCGCCA
CAAATTGCCATCA
CATTTCGCCACCT
CAAGTCGCCATCA
CAATCTGCCATCG
CAGATTGCAGCCA
CAATTTGGCTGCA
CACCTCGGCATCG
CCGAGCGCCATCA
CAAGAGGCTATCA
CCGACCGCCATCA
CACCTGGCCGGCA
CAGCTTGCCGCCG
CACAGCGCCATCA
GCCATCGCCACCA
CAGCTTGCCGTCG
CCAAGCGCCATCA
CACTTCGGCGTCA
CAATCGGCCAGCA
CGGCTTGCCGCCA
CAGCTCGACAGCG
CCATGCGCCATCA
CAAAGCGTCATCG
CAGCACGCGATCA
CTGGTTGCCAGCG
CAGCGCGCCAGCA
CGAATCGGCGTCA
TTCATCGCCAGCA
CAGATCGCCACCA
CAGGTAGCCATCG
CGCATCGCTATCG
CGAAAGGCCGCCA
TTCATCGCCATCA
TACATCGCCTTCA
CAAATTGCTGCCG
GGAATTGGCATCA
TCGATGGCCACCA
CGGAAGGCTATCG
CCCATTGGCATCA
CTGAAGGCCAGCA
CATGGCGCCACCA
CCAGTCGCCATCG
CAGTTGGCGACCA
CAAACGGCCAGTA
CAGAGTGACACCA
GAAAACGACATCA
CAGAATGGCAGCA
CAGAATGCTATCG
CAGATCGGCATCA
CGCATGGCCAGCA
CACATGGCCTTCG
CAAGTGGCGATCA
CAGCGCGCCAGCA
CAATACGCCACCA
TACATGGCCATCG
CTGCAGGCCAGCA
TGCACCGCCATCA
CCCAGGGCCAGCA
ATCATCGCCATCA
CCCATCGCCGGCA
CACCATGCCATCT
CGCTTCGCCAGCA
CGGATTGGCATCC
CAGGACGCCACCA
CGAATAGCTAGCA
CAGAACGCCAGCC
CCACTCGCCAGCA
CAAAACGCCATTA
CCGCGCGCCAGCA
CCATTTGCCGTCC
TCAAACGCCATCG
CAGATCGCCACGC
CGGATCGCCGCCG
CGATTCGCCATCC
GCGATTGCCAGCG
CGTATCGCCATCA
CCATATGCCATCA
CCTATTGCCGGCA
GAGTTCGGCATCA
CGCATCACCATCA
CTTCTTGCCATCG
TTGAGCGCCATCA
CATAACGCCATCG
CACCGCGCCATTA
CTATTGGCCAGCC
CACAGTGCCATCA
CAGATGGCCATCA
CAGGTTGCCGGCG
CCAATGGCCACTA
GGAAAGGCCATCA
CAAGTTGGTATCA
CCGTTTGATATCA
CGACAGGCTATCA
CACGTTGCCAGCT
CCAACTGCCATCG
CATATCGCCAGCC
CAGCTGGCGATCA
CGTTTTGCCAGTA
CAAAACGCCGGCA
GCCATGGCCACCA
CAGAGTGCCGTGA
CCGATCGCCAGCA
CCGTTTGCCGTCG
CGCACCGCCAGCG
CGCTACGCCATCG
CGCTACGCCATCG
CAGATCGCCGGCT
CAGAAGGCCATGG
CTGTTCGCCAGCG
CTGCACGCCAGCA
CGGCAGGCCACCA
CTGAACGCCAGCA
CAGAACGCCACCG
CAGTTCGCCGCCG
CAGAGCGACAGCA
CCAAGGGCCAGCA
CAAGACGCCGCCA
CGCTGCGCCATCA
CCGGGTGCCATCG
CAGGTGGACATCA
CAGGCGGCCACCA
CGCTTGGCCACCA
CATTCCGCCATCG
TCGAAGGCCAGCA
CACTACGCCAGTA
CAGCAGGCCATCG
CAGAGTGCCAGGG
CGCTTCGCCGGCA
CAGCTTGCCGGCG
GCCTTGGCCATCA
CCGATGGCCAGCA
CAGTTCGCCACCC
CGGTCGGCCATCG
CAGCAGGCCATCG
CGACGGGCCACCA
CAAAGTGCGATCA
CACTTTGCGATCA
CAGATCGCCGCCA
CAGTTCGCCACGG
TCCATCGCCACCA
CCGTAGGCCAGCA
CATTATGACATCA
CGGTAGGCCAGCA
CAGAAGGCCAGCG
CCCGAGGCCAGCA
CGCCTCGCCAGCC
GACCTCGCCATCG
CGCTTCGCCACCG
GGGTAGGCCATCA
CAGGTGGCGATCA
CAGATCGCCGTCA
CCGAACGCCAGCG
CAGCTTGCCGGCG
TCCTTCGCCAGCA
CACATTGACATTG
CAGTAGGCCATCA
CGAAACGCCACCT
CGCAGCGCCAGCG
CGGAAGGCCATAA
CACTGTGCTATCG
CAGAGCGCCATCA
CCGAAGGCCAGGA
CAGCATGCCGCCA
CAGGGCGCCAGCG
CAACTGGCCAGCC
CAGTCCGCCACCG
CGAAACGCCAGCG
CGTTTCGGCAGCA
CAAAAAGCCATCA
CGACTCGGCATCG
CAGAAGGCCATGG
CAGTTCGCCGCCA
CTCCTGGCCATTA
CTGCTCGACATCA
CGGTTTGCCATCG
CTGCTCGCCACCA
CACTTCGGCATCG
GAACATGCCATCC
CCGTTCGCCGCCA
CACAAGGCCATCG
CACAAGGCCATCA
TAATTCGCCAGCA
GCGAGTGCCATCA
CCTTTTGCCTGCA
CCGTGCGCCAGCA
CACATGGCCATCG
CCGATGGCCATGT
CCGACCGCCAGCA
CGGAACGCCAGCA
CCCTTGGCGATCA
CACCCGGCCATCC
CTGTTCGACATCA
CTGAGGGCCATGA
TACAGGGCCAGCA
CAGACGGCCAGCT
CAGTGTGCCAGCA
TACCTGGCCATCA
CAGAATGACATCA
CCGATGGCCAGCT
GAGCTGGCCATCG
TTGATCGCCAGCA
CAGATGGCTGCCA
CCCATCGCCACCA
CAGTTCGTCATCA
ATCATCGCCATCA
CGGATCGCCATCA
CACTGCGCCATAA
CACAACGCCAGCA
CAATAGGCCAGCG
CACTTCGCTATCA
CACGACGCCAGCG
CGTTCGGCCATCA
CCGATGCCCAGCA
CCTCACGCCACCA
CGAATCGGCATCG
CGGATCGCCAGCA
CACAGCGCCAGCG
GGGATTGCCATCG
CAGTGCGCGATCA
CAGTTGGCCAGCA
CACAACGCCGTCG
CCGTTGGCCACCA
CAGATCGCCGTTG
CTGCTCGCCAGCC
GAGACGGCCATCG
CCGATGGCCGTCT
CACATCGCCGCCA
CACAACGACAGCA
CAGATCGCCAGGC
CAACCTGCCATTG
CAATACGCCAGCC
CGGATTGACTTCA
CTGATCGCCATCC
GTGATCGCCATCA
CTGATGGCGATCA
CAGCGCGACATCA
CAGAATGCCTTCA
CGCATCGCCATCA
CAGGTTGCCAGCA
CGAATTGCCATGA
CAATTCGGCATTA
CATTTCGCCAGCA
CCTAGTGCCAGCA
CATAGCGCCAGTA
CGCTACGCCATCT
CGAAGCGCCATGA
CAGATCGCCAGCT
CAGAGTGCCCTCG
CAGATTGCCATCG
AAGAACGCCATCA
CAGAACGCCAGCA
TACATCGCCATGA
CCGTTCGCCACCA
CACTTCGCCCTCA
CTGTTCGCCAGCG
CAACTGGCCTTCC
CAGCATGCCTTCG
CTCTTTGCCATCA
CCCTGGGCCATCG
CAGAACGACAACA
CAAAATGCCACGC
GAGTTCGCCATCA
CAGATCGCCACCT
CACGTGGCCATTA
CAGACAGCCATGA
CTCTTCGCCACCA
CGAGATGCCATGA
CCCTTCGCCATCG
CGCCTGGCCATCG
CAGAACGCCCGCA
CGGCTCGCCAGTA
TACTTCGCCAGCA
CGTTTGGCCATGA
CAAAAAGCCAGCG
TCGAACGCCAGCA
CAGATCACCAGCG
CAGATCGCCACCA
CACATGGGCAACA
CAGCTGGCCATCG
CCGATGGCCAGCT
CCATCGGCCGTCA
CAGATGGCCTACA
CAGCACGACACCA
CAACGTGCCATCA
CAAATCGCTATCT
AAATAGGCCAGCA
CCTATCGCCATGA
CTCTATGCTATCA
CATAGAGCCATCA
CAAGGCGCCATTA
CGCCTTGCCATTA
CAGAACGCCACCT
CCTTTTGCCAGCA
CGCTTGGCCACCA
CGGATTGGTATCA
CAGGCTGCCATCC
CAGATCGATATCG
CAGAAGGCCAGCC
CAACTAGCTATCA
CTAGTTGCCGGCA
CACAAAGCCATGA
TATTTCGCCATTA
CTGCTCGCCATCA
TCATTCGCCATCA
CCGTTCGCCATCC
CCGATCGCCAGTA
CAAATCGCCAGCG
CATATTGCCATTA
CAATATGCCAACG
CAGCTTGCCAATA
CAAGCTGCTATCA
TCCAGCGCCATCA
CGAAATGCCATTA
CATTTCGCTATGA
CAAAGCGCTATCA
CATTATGCTATCG
CAGGTTGCCATCA
CAGTGTGCCAGCG
CACAGTGCCATTA
CATCTGGCTATCA
CAAAACGCCATCA
CAGCTCGCCGCCG
CAAAAGGCCATTA
CCTTTTGTCATCA
CAGTGGGCCACCA
CAATGCGCCAGCA
TCAATGGCCATCA
GAACTTGCCATCG
CAGTTTCCCATCG
CAAATAGCCATTA
CGAATCGCGATCC
CACAGTGCTATCA
CGAAAGGCCACTA
CACAATGACATCA
CAGTTCGCCGCCA
ACGATCGCCATCA
CTGGTCGCCACCA
CTGTTCGCCAGCT
CAGGTGGCCACGA
CCCTTCGCTACCA
CGGATCGCCTCCA
CAGCATGCCATCG
CAGTACGGCATCC
CTATTCGGCAGCA
CGAATGGCCGGCA
CAAATAGCCATCA
CACTTTGCTATCA
CAATTGGCCATAC
CAGTCTGCCGTCA
CAGACTGCAACCA
CAGAAGGCCAACG
CACAATGCCACCC
GAGGTTGCCACCA
CAGCACGCCATCG
CGCTGTGCCATCA
CTTTCCGCCATCA
ACGATGGCCAGCA
CAGAGTGCCGCCA
CAAATTGCCATCA
CATTTCGCCACCT
CAAGTCGCCATCA
CAATCTGCCATCG
CAGATTGCAGCCA
CAATTTGGCTGCA
CACCTCGGCATCG
CCGAGCGCCATCA
CAAGAGGCTATCA
CCGACCGCCATCA
CACCTGGCCGGCA
CAGCTTGCCGCCG
CACAGCGCCATCA
GCCATCGCCACCA
CAGCTTGCCGTCG
CCAAGCGCCATCA
CACTTCGGCGTCA
CAATCGGCCAGCA
CGGCTTGCCGCCA
CAGCTCGACAGCG
CCATGCGCCATCA
CAAAGCGTCATCG
CAGCACGCGATCA
CTGGTTGCCAGCG
CAGCGCGCCAGCA
CGAATCGGCGTCA
TTCATCGCCAGCA
CAGATCGCCACCA
CAGGTAGCCATCG
CGCATCGCTATCG
CGAAAGGCCGCCA
TTCATCGCCATCA
TACATCGCCTTCA
CAAATTGCTGCCG
GGAATTGGCATCA
TCGATGGCCACCA
CGGAAGGCTATCG
CCCATTGGCATCA
CTGAAGGCCAGCA
CATGGCGCCACCA
CCAGTCGCCATCG
CAGTTGGCGACCA
CAAACGGCCAGTA
CAGAGTGACACCA
GAAAACGACATCA
CAGAATGGCAGCA
CAGAATGCTATCG
CAGATCGGCATCA
CGCATGGCCAGCA
CACATGGCCTTCG
CAAGTGGCGATCA
CAGCGCGCCAGCA
CAATACGCCACCA
TACATGGCCATCG
CTGCAGGCCAGCA
TGCACCGCCATCA
CCCAGGGCCAGCA
ATCATCGCCATCA
CCCATCGCCGGCA
CACCATGCCATCT
CGCTTCGCCAGCA
CGGATTGGCATCC
CAGGACGCCACCA
CGAATAGCTAGCA
CAGAACGCCAGCC
CCACTCGCCAGCA
CAAAACGCCATTA
CCGCGCGCCAGCA
CCATTTGCCGTCC
TCAAACGCCATCG
CAGATCGCCACGC
CGGATCGCCGCCG
CGATTCGCCATCC
GCGATTGCCAGCG
CGTATCGCCATCA
CCATATGCCATCA
CCTATTGCCGGCA
GAGTTCGGCATCA
CGCATCACCATCA
CTTCTTGCCATCG
TTGAGCGCCATCA
CATAACGCCATCG
CACCGCGCCATTA
CTATTGGCCAGCC
CACAGTGCCATCA
CAGATGGCCATCA
CAGGTTGCCGGCG
CCAATGGCCACTA
GGAAAGGCCATCA
CAAGTTGGTATCA
CCGTTTGATATCA
CGACAGGCTATCA
CACGTTGCCAGCT
CCAACTGCCATCG
CATATCGCCAGCC
CAGCTGGCGATCA
CGTTTTGCCAGTA
CAAAACGCCGGCA
GCCATGGCCACCA
CAGAGTGCCGTGA
CCGATCGCCAGCA
CCGTTTGCCGTCG
CGCACCGCCAGCG
CGCTACGCCATCG
CGCTACGCCATCG
CAGATCGCCGGCT
CAGAAGGCCATGG
CTGTTCGCCAGCG
CTGCACGCCAGCA
CGGCAGGCCACCA
CTGAACGCCAGCA
CAGAACGCCACCG
CAGTTCGCCGCCG
CAGAGCGACAGCA
CCAAGGGCCAGCA
CAAGACGCCGCCA
CGCTGCGCCATCA
CCGGGTGCCATCG
CAGGTGGACATCA
CAGGCGGCCACCA
CGCTTGGCCACCA
CATTCCGCCATCG
TCGAAGGCCAGCA
CACTACGCCAGTA
CAGCAGGCCATCG
CAGAGTGCCAGGG
CGCTTCGCCGGCA
CAGCTTGCCGGCG
GCCTTGGCCATCA
CCGATGGCCAGCA
CAGTTCGCCACCC
CGGTCGGCCATCG
CAGCAGGCCATCG
CGACGGGCCACCA
CAAAGTGCGATCA
CACTTTGCGATCA
CAGATCGCCGCCA
CAGTTCGCCACGG
TCCATCGCCACCA
CCGTAGGCCAGCA
CATTATGACATCA
CGGTAGGCCAGCA
CAGAAGGCCAGCG
CCCGAGGCCAGCA
CGCCTCGCCAGCC
GACCTCGCCATCG
CGCTTCGCCACCG
GGGTAGGCCATCA
CAGGTGGCGATCA
CAGATCGCCGTCA
CCGAACGCCAGCG
CAGCTTGCCGGCG
TCCTTCGCCAGCA
CACATTGACATTG
CAGTAGGCCATCA
CGAAACGCCACCT
CGCAGCGCCAGCG
CGGAAGGCCATAA
CACTGTGCTATCG
CAGAGCGCCATCA
CCGAAGGCCAGGA
CAGCATGCCGCCA
CAGGGCGCCAGCG
CAACTGGCCAGCC
CAGTCCGCCACCG
CGAAACGCCAGCG
CGTTTCGGCAGCA
CAAAAAGCCATCA
CGACTCGGCATCG
CAGAAGGCCATGG
CAGTTCGCCGCCA
CTCCTGGCCATTA
CTGCTCGACATCA
CGGTTTGCCATCG
CTGCTCGCCACCA
CACTTCGGCATCG
GAACATGCCATCC
CCGTTCGCCGCCA
CACAAGGCCATCG
CACAAGGCCATCA
TAATTCGCCAGCA
GCGAGTGCCATCA
CCTTTTGCCTGCA
CCGTGCGCCAGCA
CACATGGCCATCG
CCGATGGCCATGT
CCGACCGCCAGCA
CGGAACGCCAGCA
CCCTTGGCGATCA
CACCCGGCCATCC
CTGTTCGACATCA
CTGAGGGCCATGA
TACAGGGCCAGCA
CAGACGGCCAGCT
CAGTGTGCCAGCA
TACCTGGCCATCA
CAGAATGACATCA
CCGATGGCCAGCT
GAGCTGGCCATCG
TTGATCGCCAGCA
CAGATGGCTGCCA
CCCATCGCCACCA
CAGTTCGTCATCA
ATCATCGCCATCA
CGGATCGCCATCA
CACTGCGCCATAA
CACAACGCCAGCA
CAATAGGCCAGCG
CACTTCGCTATCA
CACGACGCCAGCG
CGTTCGGCCATCA
CCGATGCCCAGCA
CCTCACGCCACCA
CGAATCGGCATCG
CGGATCGCCAGCA
CACAGCGCCAGCG
GGGATTGCCATCG
CAGTGCGCGATCA
CAGTTGGCCAGCA
CACAACGCCGTCG
CCGTTGGCCACCA
CAGATCGCCGTTG
CTGCTCGCCAGCC
GAGACGGCCATCG
CCGATGGCCGTCT
CACATCGCCGCCA
CACAACGACAGCA
CAGATCGCCAGGC
CAACCTGCCATTG
CAATACGCCAGCC
CGGATTGACTTCA
CTGATCGCCATCC
GTGATCGCCATCA
CTGATGGCGATCA
CAGCGCGACATCA
CAGAATGCCTTCA
CGCATCGCCATCA
CAGGTTGCCAGCA
CGAATTGCCATGA
CAATTCGGCATTA
CATTTCGCCAGCA
CCTAGTGCCAGCA
CATAGCGCCAGTA
CGCTACGCCATCT
CGAAGCGCCATGA
CAGATCGCCAGCT
CAGAGTGCCCTCG
CAGATTGCCATCG
AAGAACGCCATCA
CAGAACGCCAGCA
TACATCGCCATGA
CCGTTCGCCACCA
CACTTCGCCCTCA
CTGTTCGCCAGCG
CAACTGGCCTTCC
CAGCATGCCTTCG
CTCTTTGCCATCA
CCCTGGGCCATCG
CAGAACGACAACA
CAAAATGCCACGC
GAGTTCGCCATCA
CAGATCGCCACCT
CACGTGGCCATTA
CAGACAGCCATGA
CTCTTCGCCACCA
CGAGATGCCATGA
CCCTTCGCCATCG
CGCCTGGCCATCG
CAGAACGCCCGCA
CGGCTCGCCAGTA
TACTTCGCCAGCA
CGTTTGGCCATGA
CAAAAAGCCAGCG
TCGAACGCCAGCA
CAGATCACCAGCG
CAGATCGCCACCA
CACATGGGCAACA
CAGCTGGCCATCG
CCGATGGCCAGCT
CCATCGGCCGTCA
CAGATGGCCTACA
CAGCACGACACCA
CAACGTGCCATCA
CAAATCGCTATCT
AAATAGGCCAGCA

Quantitative data format: ChIP-Seq fold enrichment: change in detection of a region comparing the sequences complexed to the induced AmrZ to the input DNA from that sample. Range: 3.00 to 35.53

CCTATCGCCATGA 4.48
CTCTATGCTATCA 4.48
CATAGAGCCATCA 4.48
CAAGGCGCCATTA 9.6
CGCCTTGCCATTA 9.6
CAGAACGCCACCT 3.31
CCTTTTGCCAGCA 4.2
CGCTTGGCCACCA 6.49
CGGATTGGTATCA 6.49
CAGGCTGCCATCC 7.13
CAGATCGATATCG 7.13
CAGAAGGCCAGCC 5.99
CAACTAGCTATCA 5.99
CTAGTTGCCGGCA 5.99
CACAAAGCCATGA 3.0
TATTTCGCCATTA 11.93
CTGCTCGCCATCA 11.93
TCATTCGCCATCA 4.56
CCGTTCGCCATCC 4.56
CCGATCGCCAGTA 3.72
CAAATCGCCAGCG 7.13
CATATTGCCATTA 3.3
CAATATGCCAACG 3.28
CAGCTTGCCAATA 3.28
CAAGCTGCTATCA 3.28
TCCAGCGCCATCA 4.77
CGAAATGCCATTA 4.77
CATTTCGCTATGA 4.77
CAAAGCGCTATCA 6.48
CATTATGCTATCG 3.53
CAGGTTGCCATCA 4.89
CAGTGTGCCAGCG 4.61
CACAGTGCCATTA 10.67
CATCTGGCTATCA 4.87
CAAAACGCCATCA 7.12
CAGCTCGCCGCCG 4.89
CAAAAGGCCATTA 4.69
CCTTTTGTCATCA 4.69
CAGTGGGCCACCA 3.72
CAATGCGCCAGCA 3.3
TCAATGGCCATCA 5.57
GAACTTGCCATCG 5.77
CAGTTTCCCATCG 5.77
CAAATAGCCATTA 5.32
CGAATCGCGATCC 8.98
CACAGTGCTATCA 4.04
CGAAAGGCCACTA 3.51
CACAATGACATCA 3.63
CAGTTCGCCGCCA 8.88
ACGATCGCCATCA 5.49
CTGGTCGCCACCA 5.49
CTGTTCGCCAGCT 5.24
CAGGTGGCCACGA 7.55
CCCTTCGCTACCA 3.96
CGGATCGCCTCCA 6.17
CAGCATGCCATCG 6.17
CAGTACGGCATCC 6.17
CTATTCGGCAGCA 3.56
CGAATGGCCGGCA 10.18
CAAATAGCCATCA 3.69
CACTTTGCTATCA 6.83
CAATTGGCCATAC 9.66
CAGTCTGCCGTCA 9.66
CAGACTGCAACCA 9.66
CAGAAGGCCAACG 7.45
CACAATGCCACCC 5.19
GAGGTTGCCACCA 6.57
CAGCACGCCATCG 3.79
CGCTGTGCCATCA 3.79
CTTTCCGCCATCA 4.25
ACGATGGCCAGCA 4.25
CAGAGTGCCGCCA 3.86
CAAATTGCCATCA 5.19
CATTTCGCCACCT 5.19
CAAGTCGCCATCA 6.53
CAATCTGCCATCG 5.88
CAGATTGCAGCCA 5.88
CAATTTGGCTGCA 5.88
CACCTCGGCATCG 5.04
CCGAGCGCCATCA 5.04
CAAGAGGCTATCA 3.33
CCGACCGCCATCA 6.5
CACCTGGCCGGCA 11.64
CAGCTTGCCGCCG 11.64
CACAGCGCCATCA 8.38
GCCATCGCCACCA 8.41
CAGCTTGCCGTCG 8.41
CCAAGCGCCATCA 13.17
CACTTCGGCGTCA 13.17
CAATCGGCCAGCA 6.2
CGGCTTGCCGCCA 5.12
CAGCTCGACAGCG 9.22
CCATGCGCCATCA 5.78
CAAAGCGTCATCG 4.97
CAGCACGCGATCA 5.64
CTGGTTGCCAGCG 5.64
CAGCGCGCCAGCA 5.64
CGAATCGGCGTCA 7.14
TTCATCGCCAGCA 5.96
CAGATCGCCACCA 4.71
CAGGTAGCCATCG 4.71
CGCATCGCTATCG 7.19
CGAAAGGCCGCCA 4.1
TTCATCGCCATCA 4.88
TACATCGCCTTCA 4.88
CAAATTGCTGCCG 3.64
GGAATTGGCATCA 5.47
TCGATGGCCACCA 6.82
CGGAAGGCTATCG 5.21
CCCATTGGCATCA 4.35
CTGAAGGCCAGCA 3.02
CATGGCGCCACCA 4.73
CCAGTCGCCATCG 7.77
CAGTTGGCGACCA 4.42
CAAACGGCCAGTA 4.42
CAGAGTGACACCA 3.52
GAAAACGACATCA 3.05
CAGAATGGCAGCA 4.35
CAGAATGCTATCG 4.35
CAGATCGGCATCA 3.0
CGCATGGCCAGCA 7.92
CACATGGCCTTCG 3.54
CAAGTGGCGATCA 3.43
CAGCGCGCCAGCA 5.47
CAATACGCCACCA 4.48
TACATGGCCATCG 4.76
CTGCAGGCCAGCA 10.66
TGCACCGCCATCA 3.54
CCCAGGGCCAGCA 6.36
ATCATCGCCATCA 5.53
CCCATCGCCGGCA 5.53
CACCATGCCATCT 3.85
CGCTTCGCCAGCA 3.13
CGGATTGGCATCC 3.36
CAGGACGCCACCA 17.44
CGAATAGCTAGCA 8.02
CAGAACGCCAGCC 6.22
CCACTCGCCAGCA 8.41
CAAAACGCCATTA 8.41
CCGCGCGCCAGCA 5.74
CCATTTGCCGTCC 4.78
TCAAACGCCATCG 3.4
CAGATCGCCACGC 6.17
CGGATCGCCGCCG 6.15
CGATTCGCCATCC 3.15
GCGATTGCCAGCG 3.15
CGTATCGCCATCA 4.11
CCATATGCCATCA 4.33
CCTATTGCCGGCA 4.33
GAGTTCGGCATCA 12.12
CGCATCACCATCA 4.15
CTTCTTGCCATCG 4.15
TTGAGCGCCATCA 3.1
CATAACGCCATCG 4.36
CACCGCGCCATTA 5.45
CTATTGGCCAGCC 3.59
CACAGTGCCATCA 6.39
CAGATGGCCATCA 6.39
CAGGTTGCCGGCG 4.24
CCAATGGCCACTA 6.68
GGAAAGGCCATCA 6.68
CAAGTTGGTATCA 6.68
CCGTTTGATATCA 6.68
CGACAGGCTATCA 3.05
CACGTTGCCAGCT 3.05
CCAACTGCCATCG 5.76
CATATCGCCAGCC 5.59
CAGCTGGCGATCA 5.59
CGTTTTGCCAGTA 4.8
CAAAACGCCGGCA 4.8
GCCATGGCCACCA 31.09
CAGAGTGCCGTGA 21.83
CCGATCGCCAGCA 17.74
CCGTTTGCCGTCG 16.64
CGCACCGCCAGCG 16.3
CGCTACGCCATCG 13.28
CGCTACGCCATCG 12.77
CAGATCGCCGGCT 12.01
CAGAAGGCCATGG 11.59
CTGTTCGCCAGCG 11.48
CTGCACGCCAGCA 11.05
CGGCAGGCCACCA 11.01
CTGAACGCCAGCA 10.73
CAGAACGCCACCG 10.68
CAGTTCGCCGCCG 10.33
CAGAGCGACAGCA 10.32
CCAAGGGCCAGCA 10.32
CAAGACGCCGCCA 10.32
CGCTGCGCCATCA 10.29
CCGGGTGCCATCG 10.11
CAGGTGGACATCA 9.42
CAGGCGGCCACCA 9.33
CGCTTGGCCACCA 9.23
CATTCCGCCATCG 9.09
TCGAAGGCCAGCA 9.09
CACTACGCCAGTA 9.09
CAGCAGGCCATCG 9.04
CAGAGTGCCAGGG 8.83
CGCTTCGCCGGCA 8.73
CAGCTTGCCGGCG 8.73
GCCTTGGCCATCA 8.73
CCGATGGCCAGCA 8.7
CAGTTCGCCACCC 8.7
CGGTCGGCCATCG 8.49
CAGCAGGCCATCG 8.43
CGACGGGCCACCA 8.24
CAAAGTGCGATCA 7.84
CACTTTGCGATCA 7.84
CAGATCGCCGCCA 7.8
CAGTTCGCCACGG 7.78
TCCATCGCCACCA 7.78
CCGTAGGCCAGCA 7.59
CATTATGACATCA 7.42
CGGTAGGCCAGCA 7.24
CAGAAGGCCAGCG 7.22
CCCGAGGCCAGCA 7.21
CGCCTCGCCAGCC 7.18
GACCTCGCCATCG 7.18
CGCTTCGCCACCG 6.95
GGGTAGGCCATCA 6.95
CAGGTGGCGATCA 6.93
CAGATCGCCGTCA 6.89
CCGAACGCCAGCG 6.64
CAGCTTGCCGGCG 6.64
TCCTTCGCCAGCA 6.64
CACATTGACATTG 6.64
CAGTAGGCCATCA 6.59
CGAAACGCCACCT 6.56
CGCAGCGCCAGCG 6.44
CGGAAGGCCATAA 6.43
CACTGTGCTATCG 6.43
CAGAGCGCCATCA 6.32
CCGAAGGCCAGGA 6.29
CAGCATGCCGCCA 6.27
CAGGGCGCCAGCG 6.24
CAACTGGCCAGCC 6.05
CAGTCCGCCACCG 6.05
CGAAACGCCAGCG 5.97
CGTTTCGGCAGCA 5.97
CAAAAAGCCATCA 5.95
CGACTCGGCATCG 5.94
CAGAAGGCCATGG 5.91
CAGTTCGCCGCCA 5.9
CTCCTGGCCATTA 5.89
CTGCTCGACATCA 5.59
CGGTTTGCCATCG 5.58
CTGCTCGCCACCA 5.58
CACTTCGGCATCG 5.54
GAACATGCCATCC 5.53
CCGTTCGCCGCCA 5.46
CACAAGGCCATCG 5.45
CACAAGGCCATCA 5.42
TAATTCGCCAGCA 5.41
GCGAGTGCCATCA 5.39
CCTTTTGCCTGCA 5.35
CCGTGCGCCAGCA 5.33
CACATGGCCATCG 5.33
CCGATGGCCATGT 5.33
CCGACCGCCAGCA 5.3
CGGAACGCCAGCA 5.3
CCCTTGGCGATCA 5.21
CACCCGGCCATCC 5.15
CTGTTCGACATCA 5.12
CTGAGGGCCATGA 5.1
TACAGGGCCAGCA 4.95
CAGACGGCCAGCT 4.91
CAGTGTGCCAGCA 4.9
TACCTGGCCATCA 4.9
CAGAATGACATCA 4.82
CCGATGGCCAGCT 4.82
GAGCTGGCCATCG 4.82
TTGATCGCCAGCA 4.82
CAGATGGCTGCCA 4.69
CCCATCGCCACCA 4.68
CAGTTCGTCATCA 4.68
ATCATCGCCATCA 4.67
CGGATCGCCATCA 4.67
CACTGCGCCATAA 4.65
CACAACGCCAGCA 4.64
CAATAGGCCAGCG 4.63
CACTTCGCTATCA 4.63
CACGACGCCAGCG 4.6
CGTTCGGCCATCA 4.6
CCGATGCCCAGCA 4.57
CCTCACGCCACCA 4.57
CGAATCGGCATCG 4.53
CGGATCGCCAGCA 4.46
CACAGCGCCAGCG 4.45
GGGATTGCCATCG 4.34
CAGTGCGCGATCA 4.34
CAGTTGGCCAGCA 4.3
CACAACGCCGTCG 4.26
CCGTTGGCCACCA 4.25
CAGATCGCCGTTG 4.25
CTGCTCGCCAGCC 4.25
GAGACGGCCATCG 4.21
CCGATGGCCGTCT 4.21
CACATCGCCGCCA 4.21
CACAACGACAGCA 4.2
CAGATCGCCAGGC 4.18
CAACCTGCCATTG 4.18
CAATACGCCAGCC 4.17
CGGATTGACTTCA 4.17
CTGATCGCCATCC 4.15
GTGATCGCCATCA 4.15
CTGATGGCGATCA 4.15
CAGCGCGACATCA 4.14
CAGAATGCCTTCA 4.14
CGCATCGCCATCA 4.13
CAGGTTGCCAGCA 4.08
CGAATTGCCATGA 4.06
CAATTCGGCATTA 4.06
CATTTCGCCAGCA 4.06
CCTAGTGCCAGCA 4.05
CATAGCGCCAGTA 4.02
CGCTACGCCATCT 4.02
CGAAGCGCCATGA 4.01
CAGATCGCCAGCT 4.01
CAGAGTGCCCTCG 4.01
CAGATTGCCATCG 4.0
AAGAACGCCATCA 3.97
CAGAACGCCAGCA 3.94
TACATCGCCATGA 3.86
CCGTTCGCCACCA 3.82
CACTTCGCCCTCA 3.82
CTGTTCGCCAGCG 3.82
CAACTGGCCTTCC 3.82
CAGCATGCCTTCG 3.8
CTCTTTGCCATCA 3.71
CCCTGGGCCATCG 3.69
CAGAACGACAACA 3.64
CAAAATGCCACGC 3.61
GAGTTCGCCATCA 3.6
CAGATCGCCACCT 3.55
CACGTGGCCATTA 3.51
CAGACAGCCATGA 3.51
CTCTTCGCCACCA 3.51
CGAGATGCCATGA 3.46
CCCTTCGCCATCG 3.45
CGCCTGGCCATCG 3.45
CAGAACGCCCGCA 3.44
CGGCTCGCCAGTA 3.44
TACTTCGCCAGCA 3.41
CGTTTGGCCATGA 3.33
CAAAAAGCCAGCG 3.32
TCGAACGCCAGCA 3.29
CAGATCACCAGCG 3.29
CAGATCGCCACCA 3.29
CACATGGGCAACA 3.29
CAGCTGGCCATCG 3.28
CCGATGGCCAGCT 3.28
CCATCGGCCGTCA 3.28
CAGATGGCCTACA 3.15
CAGCACGACACCA 3.08
CAACGTGCCATCA 3.08
CAAATCGCTATCT 3.04
AAATAGGCCAGCA 3.04
GTCAGCCGCCCAACGGCCGCTGGCTTTCATGGCGATAGGTGATAGCATAGAGCCATCATTCGCAGCGACGCTCTGCCGCGAAGACCACGAAAGAAGC 4.48
CCTTACTCAGCTTTCAAGATAATGGCGCCTTGCCATTAGCTTGCCGATAAGAAGAAATCCCCCTATGGGCACCTGGATCAGCGACATTCCACTGAAA 9.6
CGTTCCCTGGCGGCTTGGAAAGACGGCATGGTAGAGCGTGTGATATCAAAAGGCCATATCGCTGTTCGCAGGGGACGCCGTAGCGCCCCCGCGGAGC 5.01
AGCCCTGTAGGACGGGCTTTAGTGAGCAGAGGTGGCGTTCTGCGACCACGCCGGAAGCCGACTGTTCAGTCAGAAAATTTCAGATTTTTTTTTGAAC 3.31
CAGGGGCCTGGAGCGAGGCAGAATAACCAGCGCCGCGCCGCCAGGCCAGCCTTTTGCCAGCATCGCCGGCGAGGCGTCAGTAGCGCTCGCGGATCTG 4.2
ATGATCGAAGAAAGTATCCAGGCGAAACGCTCTCGCTTGGCCACCAACTCCTTGAAGCGCGGATTGGTATCAATCCGCTGGTAGATGCTGTCGTTCA 6.49
CCGGAGCCCGAGGGACCGACCAGGGCCACCAGGCTGCCATCCTCCAGCTCCAGATCGATATCGGCCAGGACCTCCACGCCTTCATAGGCATGGCCCA 7.13
CGAGAATCGGAATGCTGGTAAGGGTACGGCGGTGCCAGAAGGCCAGCCAGCTACTCCAAGTGATAGCTAGTTGCCGGCAGGGAAGCGGAGCAAGCCT 5.99
AAGGTCTACCAGATGTTCGGATAAGTTTTTCATGGCTTTGTGCCGTTACTTTGGCGCAAGGCTTTTCGGAAAAATTTACATATCCCCCAAAACCCCT 3.0
GCACCATGATCGCCATGAACGAGGCGCCGGAGAGCAACAGCACGGCCTTGATGATCTGCACCCAGGTGGTCGCCAGCATGCCGCCGAACAGCACGTA 3.88
GGCGCAGCAGGCGCTGGCGCGCCTCGGCGATACCCAGGCGCTGGCACAGGGTGGCTAAGTCCAGCGGCGTCGCACTGGCGAACAGACCGCTGCCGGC 13.6
TGCAGATGTGCATTATTTCAGGCAACGTAATTTGGTTTTATTTCGCCATTAATTTGACGTCACAATGATGGCGAGCAGGCAAAGGCCCGTGGTTCGG 11.93
CTGCCGTTCAACACACCTGGCGAAAATCCGCCAGATGATGGCGAATGAATGGCGGATTACCGCCAACCGTTCGCCATCCGCGCCCGCAGCATCTCCC 4.56
GCATCAACGTCACCTTCAAGCCCGCCACTGGCGGTGCCCAGGAAGAAATCGAACTGCCGTTGAAGCTACTGGCGATCGGCGATTACACCCAGCGCGC 3.72
GCCTGGCGCAATGGTTGCGGGAGCAGTTGGCAGGCTGAGCGCTGGCGATTTGCTGCACTTTTCCGGCTCGGCTAGTGTCCATTGAACAGAGGCGCCC 7.13
ATCCTTTCTCGAAGTGCGGTCCGGAGCGAACGTCGCGGGAGAATAACATCATATTGCCATTACGCAATATCTCCCACGAAACGCTCAGGTTGATTTC 3.3
CGTCCTTGTAGGCCTTTTTTGGGCACCGTTATGCCAAGGCGTTGGCATATTGGCAAGCTGCTATCAGCTTTTTTGACAAGGTTTTCTTGACAGCGAA 3.28
GGTAGCTGGGCAACTGATGGCGCTGGATATGTCGTTGAAGACCCATAATGGCATTTCGCTATGATTTGCAGTCCAGTATGACGATGCCGGCGCTCGG 4.77
CGAGGAGGGCGCGCGGCATGGAGGTCTTCATGGGCCGATGATAGCGCTTTGATCGCGTCCTCCGGGGAAGGTTCGCAGGCCCGTCCTTGACGGGTAT 6.48
CTGGAATGCGAAGCAGTTCTAAAATAACTACCGATGATTTCGTTTCGATAGCATAATGCCTTTCCTCAGAAATATCCCACGGTTGCCTTTGCGTGCA 3.53
TTGCAAATCAGCTAATCACTTGAGCGTGGTGCCATAAAACCGGCACCCGAGGAGCACGACGATGTTATCGGCACTGTGGGTCAGCAAGACCGGTCTG 3.47
CTTGTCGTAGCAAAGTGGAAGCATTCCTCACCAGGAAGGCTTCCACTATGCATGCACTGGCCCGATTCTCGATCCTCGCCTTTGCTGCGCTGCTTAC 4.33
TCGCCCGCACGGTTGTCGATCCTCCGGGCGGAAACGGTCAGGTTGCCATCAGCACTGACCAGACCGCCGCTGCGGTTGTCGAGGCTATCGGCCTCGA 4.89
TGGAACTGTTCGCCTCATCGGCTACCAGCTTCAGGCCGCGTTCAGCGATCAGTGTGCCAGCGTCGTTTTCCAGGCGGGTCACACCGATATCGATGGC 4.61
GGTCGCTTCCCATAGTGGCGCCATTTTCATGACGCCACTATTTTGCCTTTGTAATGGCACTGTGCTACAAAGCCTGCCGTTCAGGCGCTGGATCATG 10.67
GAAAGTCCTTACGCAGTCATAAACTGCCGCTTTTCGACACTTCGGTGATAGCCAGATGCCACCTACCGATACCGGGCCCGTACCTGCGACGCAGACG 4.87
CCAGGCCTGCTCGCTGGGCAGGATGGTGATGCCGCCATGGTCGCTCTCGGGAATCACGAAGCTGTAGTTGCTGTAGAGCTTCTCGACATAGGCCGAG 3.9
AGCCTTGTAACCCGCCATATAACCTTGCGACTAATCCACTCCTACTAATGCCATTTAGTTGTTGCAAAACGCCATCATCGGCCTAGCCTCAGCGTGG 7.12
CAGCGTCACCCTGGGGCAGAACGGCGGCGAGCTGATGCTCAACCTCGCAGGCCTGGGCAGCATCGCGCTGTCCAAAGTACAGATCATCGGCCAGTAA 4.89
ACGGCGGGCGCAACCGGATCGAGGTATATCGTCCCGACGCTCGATAATGGCCTTTTGTCATCAACCGGTAACCGAACGGAAATAACCTGCGGTCTCG 4.69
CCATGTAATCGGCGCGCTCGCGAAAGCGCACGGCGCGCGCCTGAGATAGCATGCAGCCATCATTCGCACGGAAGCTTCGCCAATGAAATTCGGACTC 3.17
CGATGTTCGACAGCAACTTGCTGTGCGACAGCCGCATCAGCGCCAGCACGGTACCCAGCGCGACGCCGCCGAGGACGCCGAGGACCATCAGCTTGAG 5.87
CTCGGGACGACTCAAGGGGAACTCCGGAACGACGGCAGTGGGCCACCATTATCGCAGCCCACGGCCCGCAACCCTAACGGTCAGGTGAACAAATCGT 3.72
GACGACGACCGCCCCGGCAATGCGCCAGCAATCCTGGCGCTATCCACGGACGGCAAGACGCCATATACTGTATGGATAACCAGTCAAAGCAACCTTG 3.3
GGAAGGACGACTGGGGGGCTCCGAAAGGGTGGTCATGATGGCCATTGAGAGTCAAAGGGAAGTCGATCCTACTGTGTCGCGGGCCCTCGCCACAGCG 5.57
ACCGTGACCTCGCCCTGCTGGTACGCGATGGCAAGTTCCGCGAAGACCTCTACTACCGGCTGGCGCAGTTTCCCATCGAGTTGCCGCCGTTGCGCCA 5.77
CGACCAGCCCTTGATAGCCTGATTCCAAATAGCCATTAAGCGGGACGAAGAGCCCGTGAGCCAGCGCCAGCCTGACCTATCAAGGAGTCGTAGCCAT 5.32
CCAATCGCGGCGAGATCGCCGTGCGCATCATCCGCGCCGCGCAGGCACTGGGCATTCCCACGGTAGCGGTGTGCAGCGAGGCGGATCGCGATTCGCT 8.98
CTCAGCCAGGCCTGAACCCGACCAGCACACGTATCAAGGCACAGTGCTATCATTGAGGCATTCGTGCCCCAGGAGAGCATTGAAGGTGCCCAACCCG 4.04
GCCGCCGCGTGGCGACATTGACGCACGGAGTCCGCTCGGTAGTGGCCTTTCGAAATCATGCGGACACGTTCACCTGTGTACCCGATATCGGCCTGGT 3.51
GACAAGCGATAGCCCTGTAGGGGCGCGGAGTCGACAGCAGGCTACGGAATGACCGACAAACAACGGATAAAGGGCAGGCCTGTCGCTATCGACTACG 4.94
TTTCATCGCTGCAATCTGGGAAAAGAGCCCGCGCTCCACGAAATAAAGGCACAATGACATCATTGATTGCCGATGCCCGACATCGCAGTAGCCCAGG 3.63
GTGACGATCACGAACAGCTGTAGCAGGTGCACGATGGCGGCGAACTGCTGGTAATAGATGTAGTTGCCGCTGGCATTGAACAGGCTGTCGTAGGACA 8.88
CGCAGCCTGGAGCCGAGCCAGGTGATGGCGATCGTCAACCTGGTCGCCACCAGTGTGCCGGAGCTGGACAAGTCGCAGGTCACCGTGGTCGACCAGA 5.49
GCGCCTGCAAGGCATAGCGGCGCTGGCGCATGCGTTGCCGCATCGCCTGTATGTAGCTGGCGAACAGGCTCAGCCAGACCATTACGATGAACATCAC 5.24
CGAAGCGATGCACGTCGTAGCCATGGCCAATTCGCATGAAAAAACGCCCTGGTTGGAATCAGGGCGTGATTCTACCCCGGATCGGGACAGGCTTCAG 3.65
TGGCGCCGGCGTCCGGGCAGTAGGCCATGCCGGTGTAGCCGGCCTTGAAGCGCGCCGAGGCGGCGGCGATGCGGAAATCGCAGCACAGCGCCAGGTC 17.74
GGCAGCTTCTTCGGCGGCCAGTTGCTGTTCCTTGTGCACCAGGAAACTGGCGTAGTCGCCGTTCCAGTCGATCAGGTGGCCACGATCCAGCTCGAGG 7.55
ACAGAACAGGTTCTGTTCCCGGCTATCAAAATCCTGAGCTGGCACAATGATGTCGGCTATGGTAGCGAAGGGCGCGTCCGACTCCTTCCATTCGACG 3.96
CCGCAGGCTGATGGAGGCGATCCGCCAGGTCCTGTCGATGGTGCTCGAGCAGCATGCCATCGAACTGCCTCTCCAGGCCCGCCAGTACGGCATCCTG 6.17
GCAAGGTCGGCGGCGCGGAGGTTGGCGATTTCATGATGCTGCAACTGATCAATCGCACCGAGTTGCTGCTGCGCCACTACCTGGGATTGGAGCAGGT 4.91
TCGATCAATGAAAGAGATTTTTCCAGGATAGTTAGCTATTCGGCAGCAATATAGCATCGTCGGGAAACCTGGTTCATGAACAGGGTGGGGCCGGGGA 3.56
CAGCATGCTCATCTCTCCATGGGTTGGGCACGAATGGCCGGCAGTATAACGGCGCCGCGAAAGCACCGCAGCATTGCCTTGGACGTTCGCCACGGGG 10.18
ATGTATGGGGCGTGAACGCTCCGGAGACTAACCACAAGTGATGGCTATTTGAAGCACTATCCATCGGCTCGGACGAAATAGCGCACCGGCGCTTCAG 3.69
GCGCCCCTTTTACATCGCGTTGCCAAAGGGGGCGAGAATGATAGCAAAGTGGACTGCGGCACTGCTGATGGGCGCACTGGCGTGGGGATCCTGCACG 6.83
TCGGCAAAGACGTTTCATAGTCACGCAGGTATGGCCAATTGCGGCAATGCTGACGGCAGACTGCAACCAAGGCAAGGGGTCACTATCGTCATCCTGG 9.66
AGTACGGGATCACCAGCGCCTCGCCGCGCAGCAGGCGCTTCTCGAAGTTCAGCGGGATCACGATGATCGCGTACAGCTTGCGCCAGGCCAGGTCGCG 8.37
GTCTCCGCGGCGATGTCGCGGCCGCGCGAGGTCAGTTCGTTGGCCTTCTGTGTCGCGTCGGCGGTCAACTGGACATTGTTCGCCACTTCCTGGGTGG 7.45
TTCCATGCCGACCTTGCAGGTGGCTCCCGCTATCTATACTGGAAGCACAATGCCACCCCCAGCCCGCACCCGCGCCGTCCGCGGGTTTTCCGTGTCC 5.19
TTCAATGGGTCGGTACTGGGCGCCGGTGGCGCGGATTACGAAGTGCTCTCAACCAGCCAGTACCAGGCCTGGTATCCGGAACATGGTGGCAACCTCG 6.57
TGCAGACAGGCTGCAAAAGCACCATTTCGGTGCGCACCCTGTCATCGGGATGTCATCGCGCTGCCGTAGACACGGCAGCGAACCTTCGCCACCACGG 3.01
TCACCTCGATGGCGTGCTGGATCGATTCGAGCGTCGTTCTGGCCACGTTCTGCGGGTCCGCATGGGCGCTGTGCCATCACAGCATAGCAGCGTCGCG 3.79
GGGGTGGCGCCGAACTCGGTGATGTTGGCCAGCACCGGCACCTTCACCGCGGCGGCGAATTCCTTGTACATGGCCAGTTCGGTCATGGCTTCCGGGA 6.73
CGTCGTCCGTCGAAACGCTCCATGGTCAAGGCGCGCCAGTAGAGCTGCTCGCGCGGCGGCAGTGCGCCCTCGAAGCGGACCCGGAACGCCAGTTCGG 5.29
AACGGGCTTTCCATCAGCCCGGCCTGTTGCCAGGGAATGATGGCGGAAAGCACGACGATGGCCAGCACGTAGAAGATCAGTACGCGGAACACCACGT 4.25
GCCATTCCGTAGCTGCGCGGCAAGCGCAGTTCGGTCAGAGTGCCGCCATCTTCGTGGTTATACAACTTCACCGTTCCACCAGCGCGGGTCACGCTGG 3.86
CGTTTTCACTGGGTATTGCCTATCGTCGGCTGGCCTCGCAAATTGCCATCATTTCGCCACCTTCTTTCTATACTCCATCCATCGTCATCTCACCCGG 5.19
GCGGCCTTCACCGCCATGACCTGTTCCCAGTACTGGCGATTCAGTGTCACGTCGGCCGGCAGTTCGTTGAGGCCGTCGTACCAGGTGGCGAGCATTA 4.34
ACTGGCCGAGCAGGAGGCCGGACGGACCGGCGCCGATGATGGCGACTTGAGTCTTCATTGCGGATAGCCCTCTCGCTGTTATGGCTGGCCGGCGGCG 6.53
TAAGGCGGCCCCTTTGTGTTGGGGGAATCTTGGCGATGGCAGATTGCAGCCAAATTGCATGGAGATAAATGTTTCATTACAGAGGAACTTTTTATCT 5.88
ATCGCAACTACACCTATATGAGAGAAGTGAGCTGGCCGGCAGCCATCATGGCGCCGGCCAAGCCCGTCAGATTACAGATTCTTGAGTGCCGCGACTA 3.19
CGGAGCAGTACCTCGGCGAACACCCGGACGGGCCGTACAGCGATGCCGAGGTGATGGCGCTCGGTCTCTATACCAACGGCGAGTACCAGCACCTGAA 5.04
TGCCGCCGTACTGGCTGATGGCTTCCAGCCAGCGCACCGGACGTTCGAGGAAGTAGCGCGGCGACATCAGCACGCAGGGTACGCCGCTGAAGATCGG 6.15
AGCCATCCGCAGCGAGGCGCTGCACCTGCACGACGCCGGCAACATCAAGCGTTCCGAACAGTACGACGATATCGGTTTCAACTCGTTCTTCAAGAGC 3.72
CAGCCCTGATGACGAGCGTTTCCACAGTTTCGCCGAGTTCTACCCCTACTACCTGCAGGAACACAGCAACGCGGTGTGCCGCCGCCTGCACTACGTC 7.75
CGGGCTTTTTCGTTTTAATCTGCGGTCGAGGAGCCATCGTCTACCCTCAGGAACTGGTAGACCTTCGCTCGTGATAGCCTCTTGAGGTAAACAAGCT 3.33
GCAACAAGGCACCGCCGACCGCCATCAGGAGCGCCGCGAAAATCAGCCACTGTGCCTGCATGGCCACCTCCTAGACGCTCTTGAGCATGCGCCACAG 6.5
CCAGTCCAGCAGATTGACGCAGCCAGGTGATACTTCTTTGCCCGTTTCGCGACATTCCCGTGACAATCGCCGCCAGCGTGACGACGTCGGCGTTTTC 4.21
GGGGTTTGTCGGAACTGATGGTGTCGATATCCTTCCAATCGATCAGCACCTGGCCGGCATAACGGGTCTTCAGCGCCAGCTTGCCGCCGTCCATCAG 11.64
AAGCCCAGCGCGGCGAGCTGATGGCGCTGTGCACCCTGGAAGCCGGCAAGTCGTTGCAGGATGGTATCGACGAGATCCGCGAGGCGGTCGACTTCTG 8.38
AGTGCCAGGAACGGGATGCTCGACGGCGCCATCGCCACCAGCTTGCCGTCGCGATAGCGGCCGTTGCGGCTGCCCAGCAATAGCACCGCCGCCAATG 8.41
CAGGTCCGCGTAGTGAATGCCGGTGTAGAGACCAAGCGCCATCACTTCGGCGTCACTGTGGATGCCACCAGGCTGTCTGCCCAGGTACTTTTCCGCA 13.17
GGTCGAATGGGCTTGCGAAGGCCGCCCATGCTATCAATCGGCCAGCAAATAGGGGGCCGGATGGACAGTCCATGACCGGGATGAGAGTTGCTTCGCA 6.2
ACCCGGCCCATGCCGGCTTGCCGCCAGAGCTTCGGCCCCTCCAGTGGCATGGCTTCGCCACCGATGTGGATCTGCCGCAAGGCACCGTAGGAACGCC 5.12
CGATCCTCCGGGGTGAGCGCGGAATAACCACTGGCGATACGCGAGAACTGCGCAAGCGCCGCATGGCTGATGGCCACGCCCTTGGGTTTTCCGGTGG 3.72
CAATCGCTACTACCGGCAGGTCGATCGCCAGCTTGGCGAGGTGGTGCTGCAGGCGGTGCGCAAGGTGTTGCGCCACTACGACGCTGTCGAGCTGACC 9.22
TCACCTGCAACGGTACCACCGAGTGCTGATGGCGCATGGGCACCTCCATCTGCCAGGTCGCCAGTTGGGTGCCATCCGGCAGGGTGCTGGTCTGCGC 5.78
TCGCGGGAGAGGATCGGTTGGATAACTTGGCATCGTGACGATGACGCTTTGATTGCAGGACGATGAAGGCCGCTTCGCGGGATGCCCGGCGATGCTT 4.97
CACCGGTGATCGCGTGCTGGTCGCCTTCGGCCGCCTGGTTGCCAGCGAGCTGCGCGAGGTCGACGTGCTGGCGCGCTGGGGTGGCGAGGAGTTCATC 5.64
CACTCTGCGGTGGCGCCGGCAGGCGATCGCCATGCACCGTGACGCCGATTCGATAGCCCTGCGGCGTGCGGCGGAAAGTCAGGTCGGACGCTTCCGC 7.14
GGACGTAGTCCAGGCCATCGTTGTTGAGTACCGCGGGAGTGGCGCGGTTGGGGTCCAGTTGCATCACCTTGCTGGCGATGAACAGGCTGTAGTAACG 5.96
CAAGCAGTTGCAGCCGGTGGCCGACGCCATCCTGCCGTTCGTCGGCGATGATTTCGCCACTTTGGTCGACCGGCAGATGGCACTATTCTGAGGCTCA 5.45
CGGTCTGGCTGGTTTCCAGCAGCGGCTTGCTGGTCTTGGTGGCGATCTGGCTATGGGTGGCCAGGTAGCCATCGGTGCTGCCCAGGTTGTTGCCGAG 4.71
GCCTGCCCAGCAACCTGATGCTGGAACGGATCGGCCCGCGCCGCTGGATCGCCTGCCTGATGCTGGTCTGGGGCTGTCTCTCCACCGCCATGCTGCT 5.62
CAGCGTTGAACAACGGCGCGTTACATCCGGCGACAATGTCATACAAGCATCACGCCCCTGTCACAGGGGTGACACCGCGCCTTCCTAGCCTGAGCTT 7.66
TCCAGCGCCAGTACCTGCTGGGCGACCCGCTGGCCCTCGCGCGGCGCTTCGATAGCGATGCGCCAGGGCGTGCCGTCCGGCTTGCGCCCTTCGGCTT 7.19
TGTACATCAGGACATCCTCTTGATCACGGTGCCCCGATAGTAGAGGGATGGCTGGAACGCGTCACCCTGGCGGCTTGCCGCTGTCTGATTTGCCGGC 10.29
CGGGACAGGCGATCACCAGCCGAAAAGTGCGCATGGGTATACTCCAGAAACATCGCGAAAGGCCGCCATTCTAGCGGCATGGCGGGAAAAGTTCAGC 4.1
GAGCATCATCAGCGGAACGCTGTCCAGCCCCATCATCGCCAGCAGGGTGATGGCGATGAAGGCGATGTACGAGCCGATCATGTACACCTCGCCGTGG 4.88
CTCCTCCAGCCCCTTCAGGTAGTTATCGCCAAATTGCTGCCGGAACTCTGGCGAAGTGGCCAACTGCTCCAGAGCTGCATAGGTTTCCCTCCAGTTC 3.64
CAACAGGAGACCGGGGAATTGGCATCAGTTCAGCCGGCCGCGTGCCCCTGGAATGACCTCTTTCTGACCTGCCCGTCGCTCGTCCGGCCTTTCGCGT 5.47
CAAGCGCCTCTACAACGGCCCGTTCGATGGCCACCACGACCGCCCGGTGACGCCCTGGTCCAAGCATCCGGCCAGCCAGGTGCCGGACGGCTACTAC 6.82
GCCTTGTCCTGTTCGACGAAGGCCTTGCGATAGCCTTCCGGACCCATCTTGCTCAGCACCAGGTTCTCGAACACGGTGCCGTCCTGCCACGGTTGGC 5.21
GTAGACGGTATCCTCGGTCATGCGGACCAGCATGTCAGATAGCCCATTGGCATCATCCGGGTCAATATAGCTGCCCGCCTCGCCGGCCACCTCCGGC 4.35
AGGAAACCTTCGACCAGATCAATGCTGGCCTTCAGGCATTGTTCCCGAAGGTATTCGGCGGCGGTACGGCATATCTGGAACTTACCGGCGAAGATCT 3.02
ATCACGCAGAACCGCCATGGGTAGAGGGCGCCCTGGAAATAATTCAGTTTCATGGCGCCACCATCCTGACCTCGGCCGGGTCGGGAACGCGCATGCG 4.73
GGACCTGCCCGTCCTGGCGCAACTCGGCGCTCCAGTCGCCATCGCTGAGCGGCTGTTGCGCCAGCGGAATGTAGTTGACTCCCTTGGCCAGCTCCAG 7.77
TCATACGGGGTTACATCGGTGGTGGTCGCCAACTGGTACGCCTGCGCATTCAAACGGCCAGTAAAGGTGTCCCCGCGATAGGTCAGAGTGCCCCGTT 4.42
TAGCCAAACACTGAAAGCGCCCATTTCAGCAGGAGAATACAGACGAACCAGTAGCAGAGTGACACCAATCGTTATGAGCTGTGCTCCCAAGGTGCCT 3.52
ACCAGCGGCCAGATGACCGAGAAATCGTGCTGCTTGATGATGTCGTTTTCGTTGCCATATCGGAATGTGCCGCGGGAGGAATCAAAGCGCCGAGCAT 3.05
CGCTTCAGGGCCAAGATCAGGCAGAATGGCAGCAACATCATGGTAAATATGAGCATCGATAGCATTCTGCCCACGCCATTGCCCAAATAGCGCAAAG 4.35
TGACCAGAGCGAGCAACATCACGCCAACGACCAGACTGATGCCGATCTGCATCCCCCAAGCCTGTACCCGTTCGGATAATGGGCGCCCGCGCACCCA 3.0
CGGTGAAGTACGGGATGATGTCCCGGCGATCCGAATCCAGCACCTTGAAGGCCATCCCATGCAGGTGGATCGGGTGCTGGTACTGCGCCATGTTGCG 3.22
GATTCGAAATCCGTTGAGTCAGCAATGGCTCCTAGGGTTCAAATCCCTATCTCTCCGCCATTACATATGAGCAAAGCCCCTGGAATGCCTGGCGTTC 3.01
GCTGGAGCATGTCGGCGGCGGCAGAGCGGGCATAGACGAAGCATTCCAGCAGCGAATTGCTGGCCATGCGGTTGGCGCCGTGCAGGCCGGTGAAGGT 7.92
GCGCTTCGATACCCGTCGCGACAGCCTGTCCTGGCAGAACGACCTGACCCTGGCCGAAGGCCATGTGCTGACCCTCGGCTACGACTGGCAGAAGGAC 3.54
ACCTCTACCTGCATGGCACGCCTTACCTGCTGGCGCCGGACCAGCAGAAGCACGTCGGCATGCTGGCCTGGTTCTCGCCCGGCTACCAGAGCGCCTT 7.37
CCCTCCTCGGCGGCAGACCCATGGCTTTTCACCACTATCCCCTGCAATCCGAGGAAACTGGCGCCGTTATAGCGTGCCGGAGCGATATCGCCGCGCA 3.64
GTATTGTCGCGCGTCAAATTGACCGAGCGTACGAACGGCATGATCGCCACTTGCTCGCGCAGCGCCAGTTCGGCCTCGGGACAGGGGCGCCCCGCCA 3.43
GACAGGCCGTCGATCTGCGCGAACTGATGACGGAATAACGGCGCCATACCGGCAAGGCGGCCTCATACGAAAAAAAGGCGCTGCTCCTTTCGGAACA 6.23
GCGGGGAATGACGCTAGCGGCAACATCCCATCCCCGTGCAGCTGCGAATCCCTCAGCGCGCCAGCACTCGCCGGTAGAACAGCACGCAGATCGCGAC 5.47
TTCTGGCAGGGCTCGACCAAGCAGTTCCCGCACCGCTATCGCTTCAACATCATCGACACCCCCGGCCACGTCGACTTCACCATCGAGGTGGAGCGCT 5.42
CGGCCGTCGCCTCACTCACTCCAGACCCGCTCCCGCATCCGCTCGCAATACGCCACCAGGCGCGGATAGCCTCGCGCCACATGGCTGAGTGGGGTAT 4.48
GTGACCCAGACCCTGCAGCGCTTCTACATGGCCATCGCCCTGCTGCTCAACGCCGGGCAGAACGCCCTGACCGCCGAGGAACTGGAGAACCTCTGCA 4.76
GACCATCCACGGCGAGGTCGGCTGCCGGCTGGCCATGTCGAAGCCGCCATTGAGCGGCAGCGACGACATCAGGCCGACCACCGGCCGCTGCGGCTGT 8.48
AGGTGCACGAGATGCCAGTCGTTGGCCAGGCCCTCCTGCGCCGAGTACTGGCACATGGGCGATACGGCGATGCGGTTGGGCAAGGTGATTTGACGCA 3.62
GGTGCAAAGCCGCGCCCCTGCTGGCCTGCAGCCATTTCCACTCAGGCCTGGCGCTGACGCTTGGCCTGCATCTTGCCGGCCATCGCGGTCATCTCGT 10.66
TGTCCGCCGGATAGTCGATGTACTGCACCGCCATCATCCAGATGCCGAAGAGGATCCACAGCGGCGTGGCGATCAGGTTGACCCCGGGCACGAAGCT 3.54
TGTCAGTTTGTCCGCCCAGACGGTTTGATGCTGGCGCAACAGCTCGGCTTTTTGCTGGCACTCATCGAGTTCGATGCCGGTTCGCTGGCGATCCTCG 3.4
ACCAGCGCCACACCGATACCCTCGGCGACATGCTGGCCCTGGGCAAGAGCAATGGCAGCGAGATGCCGCAGTTCTACCGCTGCGATCCGAAACAGAC 6.36
CGCACTGCATCATCATGGGCATGCCGCAGTTCATCATCATCGCCATCATCTCGGCGCTGTTGCGGAACTGGCCCATGTCCATACCCATCGCCGGCAT 5.53
GGCTCTGGCGTGCGTCTCGACCGTTCGTCCGGTGTCCGGGTTTCCGGTCGAAAGATGGCATGGTGCTATCTTCCCGGCGTTGCAGGCTGAGCTGGGC 3.85
GCGACATGCGGCGTTACTGCGGCGCGCTGCTGGCGCCGGGACAGCGCTACGACTGCGACGACATCCGCGACGGCGACACGCGCCGCCAGTGCCGCGC 11.75
CGAGCCAATAGACTCAGGCTATGAAAACCATTGAGAAACGCCTATGCATCGCTTCGCCAGCATCGCCGAAGCCAGGCACCGCGCGGCATGGGGGAAG 3.13
CAGCAAGCAACCGACGGGGATGCATCATGTCCCTCCTTTGTCATTAGGATGCCAATCCGCCAACTGGGTGATTTTGATCACCCCATATAGCGCTGCC 3.36
TCCAGCGCGCCGGCCGAATTGGCGACAATGGCTGTCACTTCACCGGCATTTCGCCCCAGCACGACCTGTGCGATACCTTCATAGCCACAGCGCATAT 3.23
CCGCGGAAAGCTACGCGCTGGCCATCGCCCTGCTTTCCGACCGCCTGCGCGGCGGCAGCGGCCTGGTGGCGTCCTGGCCGACCGACGACCCGGGCAT 17.44
CCGGCGAATAGCTAGCAGAACTGCGACATGCTGTCGCAGTTCTGCCATTTCTCCGCGTCTATCCTGCCCATAGGGCAATTCGCCTTTGGTCTAACGA 8.02
CTATCTGCAAGTGCATGCGCAGACGTATTCCAGGCGTAGCGAAAACATATCGAAAGGCCAGTCCCGCCGGGCGTGGCGAGTATTCCGCCAGGGGCTA 4.55
CGCGCGGGCGCGACGAAGTGTCCGATACGGCGCGCGCCTTCAATATGATGCTGGAAAGCCAGCAGGCGCTGCTTCGGCATCTCGCCGAGACAGCCAG 6.54
GGGCTGGTGCTGCTGCAGAACGCCAGCCGCGCGGAGGCCTGGCACGACTGGTTCGCCAGCCTGGAGCGAAATTGCCAGGGTTGCTACCACGGTCCAC 6.22
ACCATGGCGGCGCTCCGCTAGCGGAGCGCCAGCTTTCCGACGAGCGCCTCGGCCACTCGCCAGCAAAACGCCATTATTCCGTCGAAATCTCTCCGAA 8.41
GCGTCTACGGCGGCGTCGTGCCCGAGCTGGCCTCGCGCGACCACGTCAAGCGCATGCTGCCGCTGATCCGCCAGGTGCTCGACGAGTCCGGCTGCAC 7.06
GCCCCCAGCCCGGCGGCAACGCCAGCGGGCCGCGCGCCAGCAACCTGACGGAGTTGCGCCAGCAACTGACCCTACAGTTGCAGAGCAGCCTGGAGGC 5.74
TTGCTGGCAGTGGACGCCAAGGAGGCGGACGGCAAATGGCAGGCGCAATGGCGGCTGTGGATGGGCGATTCGCGAGAGCAAGGCCAGGCTGAAGGCG 4.78
GGATCTTGAGCGTCATCGATGGCATCGGTCAATGCCGCTAGTCGGCCTTCCTTCTGCCATTGGGCGAACAGCTCGGGATAGCGCGAGCGCGGCGCGG 3.36
CCTACAGCAGAGGTCAGCTTTATACCATGCGGCCGACAGGTCGCCCTTCAAACGCCATCGGTTTCTGCTAGAATGGCCGGCTTTCTTTAACGACCCA 3.4
GCGGAGGTCGCCGCCGAATTGGGCAACAGCGTGGCGATCTGCCGGCAATGCTACATCCACCCGGCGATCATCGAGGCCTACCAGGCCGGGCAACTGG 6.17
TTGTCGGTCAGCACGCCTTCGCGGTAGACCGGATCGCCGCCGAGCTTCACCAGTTGGCGGGCGACGTGGCTGCGAGCCATCGGGATGACCTCCACCG 6.15
TATAAATGGCAGTTTTGTCCTTGAGTGCATCGAATGCTGACCAAACGATTGCGCCAGAGCGGCGTAGTAGTCTCCTGCCTGCTCGGTAGCGTCCTCT 3.8
CAGTGACCAAGGCCCGCACCTATACGGTCACAAGGATGGCGAATCGATGCTTGCTTCAGCGATTGCCAGCGGTACCGCAGTCTCCCAGGTCTCCAAG 3.15
CGATCACCGCTGACGGTTACTGGTTGTCCAGTGCCGGGCGCTGGCCATTGATGGCGATACGCTTCGGCTTGGCTTCTTCCGGAACCAGCCGGACCAG 4.11
AATTCCAAAGCGTTCTTTCCACAATAGCCAAGCGCCATTGATGGCATATGGCGCGCAGACTTCAATGAAAATCATTTTCCTATTGCCGGCACTGGGC 4.33
AGGCCAGCAGGCCGCGCTCGGGCTGGTAGCTGTAGTACAGCGGCTTGATGCCGAACTCGTCGCGCAGCAGGGTCAATTGCCGGGTCTGCGGGTCCCA 12.12
GGCCTTCAAAGGCAAGGACCCGCGCATCACCATCATGTCGGCCGGCCTGCAGAGCGATGGCAAGAAGCTGGACTGCGACGACATGGCGGCGATCCTC 4.15
AAGGCCGGCGACATGCGCGGCAGTGGCAAGACGATACGCAGCGGAGGTTGGGAGGGCACTACCCTGGCTCAGGTCTGCCGCGATGTTGGCGCACGCA 5.6
GGGTCTGGCCGCGATGCTTGAGCGCCATCAGCACCTGTAGCGCCGCGATGATGGCATCGCCCGTCGTGGTGTTCTGGCAGCAGACGATATGCCCCGA 3.1
CGTTGAGGGGCAAGGGAATGGGAAGTTGCGACATGACTTCAATGTCCTTTTGAGGTCGGTTGGGAAGAACGCAGGCCCAGCAATCCCCTGAACCCGA 3.13
CGTAGACGGCGAGCGGATCGGCAAGCGGGGAAAACGGCATCGAACCGATTGAAAAACGTCATCATCGCTTTCCCGACGAAGGTAGGGCCCGCGCTAT 4.49
CGTCCGGCCAACTTAAAGTTCGGTTGTGCCGACTGCTGTCATAACGCCATCGTTCAGTGGCCTCGGTGAGCCCCCGTACCCCCAGTTCGCTGGGGCT 4.36
CGGCCATGCCGATCAGCCCGGTCATCACGCCGATTTCCTTGTGGAAGCGCTGCGGTACCAACTGGAACACCGCGCCATTACCGGCACCGAGACTGAG 5.45
AGCGCGCGACCGGGACGGGGCTACCGTATGGCCAAGGGCCATGCGCCTGGCCCGGTTGGGCCGACGGCTGACAGACAGCGCTCGGGGCGATTGAGTT 4.19
AGCAGCGCGCCAGATGATCGTACAACCCAGTGCCGTCGCGAAAGGCTGGCCAATAGCCACGACACTCCTGCCCGCCTCCTGCGGACCCGCCGACCCT 3.59
GAAAACATGTCACCGCAGGTACCGTCACACCACAGTCACACAGTGCCATCAGGATGTCCCTCCTGGGTGATGGCCATCTGGCCTGAACCGGGTAGTT 6.39
TCTGGTCGATCAGCGTGGTCTTGCCCTGCTGGCTGATCTTGATCTCGTTGGGGTTGAACTGGGCACCGGTAGGTGCCGCCATGGCCGCGTTGATGCT 7.94
GTACTTGAGCGTACCGTTGAAGGTCTGCAGCGCCAGGTTGCCGGCGTAGTTGTCCCAGGAAGCCAGGTCGATGCTACCAGCACGGCCGGCGAGGTTG 4.24
GAGGAAATGCTGTTCCGTGCCATGGGCGTACCGGTGGCCCATGGCAATCGCTATGCGGTGGTACCCTTCCTCCGTCGCTGGGCGCAGGCCAAGGGGA 3.58
GCCGCCATGCATTCTGCAACTAGTGGCCATTGGCAGGCATTTAACGGAAAGGCCATCAAGTTGGTATCAAGTGATATCAAACGGATATTTCCAAATA 6.68
CCACTTATGCGGGGCGAATGGAAATGCCACTCGTTTGCCATGATAGCCTGTCGACATCCTCTGGAAATATCGTGAAAAAAGCTGGCAACGTGCGAGA 3.05
GCCAACTGCCATCGGCACGCTTGGCCAGGCTGGCGCGATGCAGGCCTTCCAGGCGCGGGATGTAATCGCTCATCCACAGCGACAACGGATGCTCCGC 5.76
AGCCGCGCCGCTCTGCGCCGGGGGCCAGCAGGATGGCTGGCGATATGATCGCCAGCTGCCCAGCCGGATTCAGCCGCCGAGCATGTCGTGCATGGCG 5.59
CATCCAACCCCCAGTAAAAAACTAGGCTTTTGCTGAATCGCTCGCATTTCAGATAGCTGGTACTGGCAAAACGCCGGCACGCAACGCACAATTGACG 4.8
TGTTTGTGCCACTTTTTTATTGACTGGACGCCACTGCTTTAGCGCTGCATTAGCTGCATAGAGGTACCGTTTTGATGATCACTGGCTACGGTGCGAC 35.53
TGCTGGTGGTGGCCATGGCGTCCGCCGGCCATTGCGCCGGGGGCACGAAGCGTTCGCCGCGCCGCTCGAAGAGCAGCACGCGGGTACCCAGCACTTG 31.09
CCGGCATGCACCGCGACTACCTGCGCCACTACCGCGACTACGATCCGCTGCAGCCGCGCCACTGCCTGGCCAGCGCTTCGCCGGTGGTGCCGCTGCG 24.77
GACGCCAACCCGCTGCGCCTTACCGGTTATGGCGCTCTCTATAACCCATTACTGAGCGCCCATGTCTATGGCGCCTTCACGGCACTCTGGCTGGCCT 21.83
TCCGGTGAAGCCGATCGCCAGCAGTGCCAGGGCCAGGTTGAAATCACTGTGGAACCAGACCGCCGCCGCACCGCCGAGTGCGTTGGCCGGTTGCGCC 17.74
GCGATGCTGATGCTTAGCGGCCGCCTGCGCAGCACCGAGCCACGCCTCAAGCTGCACTGAGCCATTACGCCCCGTTTGCCGTCGGCGCGGGGCGTTC 16.64
CGCCTGGGCCGAGCAGGAACTGGCGCACCGCCAGCGGCGCGACCGCGAACTGGCCGCGTTACGCTTTCCCCACGCCGAATTCCGCCACGGCCAGCGG 16.3
GGTAGAACATCAGCACGGCGATGGCCACCGTCAGCCAGGTGGCGACCATGTTGCTGGCGAGCATGTCGAACAGATCGACGTCCGGATAGCTGGCAAA 14.16
GGCGTGGCGGCAGGGCTGCTGGTCATGCTCGGGCGCTATCGCTACGCCATCGACGGGGAGGCACGCAGCCATGGGCGAGACTGAACGGAGCAGGGCG 13.28
CCGGCGCCTGGAAGGCGTAGTCGTACTCGGCGATGGCGTAGCGGCGCCAGTCCGCCGGCGGCGCGCCATGGACGAAGGGCAGCAGCGAACGGCCCTC 12.77
CGAGCTGCCGATCAGGGCGTAGATCAGCATCGGCAGGATGCACGCATAGAGGCCTACCTGGGGCGGGAAGCCGGCGATCTGGGCGTAGGCGATGGCG 12.01
GATCTTGACCTGTTGCGCCATCACGCTGGCGCCGGGAGCCTGGCGAAAGTCCACGAACAGCCGGTCACCCTCGTGGCGTATCGCCTCCGGCGGCACG 11.59
GGCGTCCACCGCGGTGAGGATGAACAAGGCCTCGAAGAGGATCGCGAAGTGGTACCAGAAGGCCATGGTGTTCTCGCCCGGCAGCACCTGGTGGAGG 11.59
CGGCGCCGGCCTGCAGCCAGGCCGGACGCAGCAGGCCGCTGGCGAACAGCAGCAACAGTGCCGCCAGGCCGACCACCCCGCCCGGCAGCGGCAGGCC 11.48
TGCTGGCGTGCAGGTCAACCACAAGCGGATCTATCGCCTGTACCGCGCTGCCGGCTTGATGGTGAAACGGCGGCGCCGCCGCCATGGCATCGCGGTG 11.05
GTGCAGGTGATGCCGCCGCGGCAGGCCACCACCAGCTGGCCCTTGCGATGCCGGTGCACCGGCACTTCGGTGTCGTTGTGCCGGGCCTCCAGCTGCA 11.01
CCGGCGCCGAACGCTACGCGCTGTGCCTGGCCGGCGATTGCGCAGCGATGAGCGGCGACAACGACAGCATCTGGCTGCAACAAGGCAACCGCGGCCG 10.93
AGAAGCAGTATTCGAAGTTGCCGAAGGCTTTCACGCTGCTGGCGTTCAGGCCGATCAGCAGGGTCGAGAAGGAGATGATCCAGACCCATTCCGGGAT 10.73
GCTCTACCCGTTGCTGGCGCTACCGGTGGCGTTCTGCGTCAGCGCCGCCATCGGCATGGCCCTGGAGCGCACGGTGATCCGCCATCTCTACGGCCGG 10.68
GGCGCGGGCGAGCAGGTGCTCGGTGAGCGACGCGAGCAGTTCGCCGCCGTTGCGCCAGTAGTGCCAGTACAACGGTACGTCGATGACCTGGCCGGGC 10.33
CGCCAGAAGAACACGCCGAGGCAGAGCGACAGCAGGCCAAGGGCCAGCAAGACGCCGCCAGCGGCGGGTTCGATATGCAGCATGCCGACAGCCGGCT 10.32
CCGTTGCGACGTGGCGAAGGCGACAGCCTCGCCCGCTACGGCAGCAACATGCTGCCGCTGCGCCATCAGCCGACGACGCCGACCTCGCCGCTGTTCA 10.29
AACTGGGGCGGCTGGTACAGCAACTGGCCGGGTGCCATCGGGCTGTACCGCTACGTGACCCTGAAACGCTATCCCACCTGCGCGGTGATGACGGTCA 10.11
CCCTGGGGCGAGGGGCGCCCGGGCTGGCACATCGAATGCTCGGTGATGTCCACCTGCTGCCTGGGCGATTCCTTCGACATCCATGGCGGTGGCAACG 9.42
CCGCAGGCGGCCACCAGCACCACCGCGGTGGCCACCGCCGCCGCGTAATGCGCATGGGACATCAGCACGCCGGCGCCGATGGTGCCGGCCAGGATCG 9.33
GGCTTTCAGCTTGTGCCGCTTGGCCACCACTGGCGGCGCGGTGTCGTCACGCCAGCTCACCGCCTTGAAGATGGCTTTTTTGTCTGCCGCAGTGAGC 9.23
GGGAATAGCTACCTAGAGCCCATTCCGCCATCGAAGGCCAGCAACTACTGGCGTAGTGGTGTCCGGGAGATTGGACAGGTCACCTTTGATAGCATCC 9.09
CCTGGACACGCCCTTCCCGGCGGCGAAACAGAAGCATGTCCAGGTCGCATCGATGGCCTGCTGGTGCAGGATCGCCGACGACTGGCCGCGTTTCGAC 9.04
GGCGCACCTGGCGGGCCAGGCCGAGGTGGCCGAGGGCCAGGTCTTCGATGCAGATGCCGCGTCGCCGCGAGGTCACCGCGACATGGTCCGCCGCCAG 9.04
ACCTCGCCCTCGGCGTCGACATAGCCGGCCTTGGGCGACCAGAGTGCCAGGGTGCCGATGGCATAGGTGAAGCGCGAGCCGGGCACGACCTCGCCTT 8.83
CGGCGGTGCAATGGATCCTTGGCGCCATCGTTCTGCTGGTCAACCTGATCGCCTACCTGTATCTGTGGCATTGCCGCAGTAGCCGCTGAGCCACGGA 8.81
TGGCGGCGGAGGCACACTGACATGTGGCAGAGCTATCTCAACGGCATCCTGGTGGCTGCCGGCCTGATCATCGCCATCGGCGCGCAGAATGCCTTCG 8.81
GGTACAGGGCGATGCCGTTCTCGAGGGGCACAATGGTATCGTCGATGCTGTGAAAGAACAGCATGGGTGCGCCAGAAAGCCGCGCCACCGAATGGAT 8.74
CTGCACCCCCAACGAGGCCGGCGTCTCGCTGGCCGTTATCGAGCGCTTCGCCGGCAAGCTGCCGCTGCTCGGTGTCTGCCTTGGCCATCAGAGCATC 8.73
CGATGGCCAGCATTACGCGGTGGGCTACCGCCTGGACGGCAAGTGCCAGTTCGCCACCCGCGTGGCCCAGCGCTGCCACGACATCGTCCAGCACCCG 8.7
CTCTCTGGTTGTTGTGAGCGGGAATGCGGGCAGTCAGGCCGGCAGCAATTGCATGGCTTCGGCCTGGCTCAGCGGCACCTCGCCGACCACCCTGGCC 8.61
GGCCCCAGGCCAAGGCGGGAGGCGCGGATGCGAAAGGGCGCCATTTTAACAGCGAAGCGTCGGGCCGGCAGGGCTAAACGATGGCCGACCGCCGTCA 8.49
GTGGCGCGGTGTACGTCCAGGTCGTGGCGGAAGGCATCCAGCAGGCCATCGTCCTTGGCCAGGTGGGCCATGATCCGCAGCTCGATCTGCGAGTAGT 8.43
CGCTGAGGATCAGCCAGCCGGCGAAGGGCAGGCCGATCATCATCAGGTAGAGGGCGTAGTGCATCAGCCTGGCCAGCGTCGCCTGCCAGGCGGGGAT 8.34
GCTGGCGCAGAGCCAGCGGCTGGTAGAGAGCAGGCGACGGGCCACCAGGGTGGAATCCTCCGGCTGGCCGACCATGATCACGATGTCGACGCCCTCC 8.24
GGCCAGGCGCACGCCCTGGCTGCTCGGCGGCGACCTCAACCTGCTGCCGCCCGGCCAGTATCCCTACCTGCTGGCGCCGCTGCGCGCGCCCTACCGG 8.15
GCGCACCGCGCTGGCCAAGCAGGGCGAGGACGACTTCTACGCCAGCAAGCTGGGTACCGCGCGCTTCTACTTCGCCCGCCTGCTGCCGCGCATCCAT 8.11
CGTTACGCACGGCGAAGACGTTGAAGGTGGTGTCGTAGTGATCGTGCTCCAGCGGCGCGGTGGGCGGCAGGATGAGATCGGCGTAGCGGGTCGTCTC 7.92
ACACCGGCCTCAGCTTCGGTGCCTGGAAGCAACGCGCCTGCGTGGTGCAGGCACTGGCGCGGCTGGCCGGCGGCGAAACGGTCACCGCCATCGCCCT 7.9
TGCACGATGAACAGGCGCCTTCCGGGCACTCTGCTGATCGCACTTTGCGATCAGTCCGCGCCCAATCGCCGTGGTCACGCTGCTCCGGCGCAAGCGG 7.84
ACGCGCCGCTGAAACGCAGCCTCAGGCTGGTCGAGCTGCTCGCCTGGTGCCATCGCAACGGCGTCATCGACAGCGCCACCCGGCTGTCCCTGCATCC 7.81
GGAATTCCCTGCCCTGGACCACCGCCTCGCGGCAGATCGCCGCCAGCCAGGCGGCGAAACGCTGGCTGGCCGGCGAGGCCTGGTGGCTGCGCAGGTG 7.8
CCGGAATAGTCCGCGGCGCGCCCGGCGACCTGCGCCAGGTAGTCGGCCGGGTTGCCGCCGCCGCGCAGGAAGTCCGCCACCAGTTCGCCACGGGAGC 7.78
CTGAGGGCCAGTTCGGCCGGGTTGTCGTCCATCGCCACCAGATGGCCCATGCCCACCGCGGTGGCACCGCCGCGGCGGCTGTCCAGCACCAGTACGT 7.78
AGGCCGCGGCACAGCGCTCCGTAGGCCAGCACGACGATGCCGTTACGCTCGGCGTAGGGCAGCACGTCGGCGTCGATGGCGCGCTCGAACAGGTTGT 7.59
CCCGCCTCCACCGTCAGTCGCAGATAATCTGAGCCCAAAATCGCGCTGATTGCGAGCCCGCCGGTTTTCGACTGCAAGCCGCTACAGCTATGTGATC 7.52
TTCGACGAACGGTCGCGGCAACGCCGGCGGGCGGCGTGATGTCATAATGATGCGACCCGTGCGCCAGTCGGGTATCCTTGCCGGCCTCTCAACGTTG 7.42
CACCGATCACCGCCGTGGAATATGGCGACAGGACCCTGCTGAGCCATCCCCACGGCAGCATCCTGGCCGACCGCCTGGTCCTCGCCAACAACGCCTT 7.4
ACCCTGACGCTGCTCTACGGCGCCCACGACCAGCAGCACAACAATGCCGTGGTGCTGGCCGAGTTCCTCGAGGAGGAGCTGGACCGCCAGCAGCCGG 7.36
GACATGGGTTTCGTCGGCAGCATCGCCGACCATGTCACCGTGCTGCACCAGGGCCACGTGCTGGCCGAAGGCTCGCTGGCGGAGGTACAGGCCGACG 7.27
GGTCCGCAGCACCGTGCGCATCTGCCGGACGTTGCCCGGCCAGCGGTAGGCCAGCAGGCCCTGGCGAACCTCGCCGTCGAGCTGGATGCGCTGGCCC 7.24
CAGCCGCTGGTGTCGCTGGATATCACCGCGCTGGCCTTCTGCCTGACCTTCTTCGTGGTGCCGCTGCTGTCGATCATGACCAATGCCGCGAGCTGGC 7.22
AACAGGGCGTGTTCCGTGGCAGCGTGCTGCCGCTGCTGGCCTCGGGCCACGCCTTCAATACCGAGGTGGACAACCTGAAGATCAGCTGGGACAACAT 7.21
GCGCCGGCCCTTGGCTGGCGAGGCGACGTTCCAGCACCAGCACCGCGAAGGCCAGCAGCAGGCAGATACCGATGGCGAGGTCGGCCGCTTGCCCGGA 7.18
GCCGCCGACGTGGTTCCAGGCCACCACCTTGGCCGGCACCTTGCTGCCGTAGCGGGCCCAGACGGTCATCGGCGACAGCAGGTGGATGACGTTGACC 7.17
TGCGCAAATCGCCCGGCGTTGCGCCAACGCCGGCACGGCGGCGCAACGTTGCCATTCGCGCAAGGTCGCTCAACTGGCGGCGCGCTGTCGCAGACAA 7.05
TGACCTGAAAGTGGCCATTCCCGGCCTGGCGGTCAGCGGCCACGGCGATATCGACCTGCGCGTGCTGGGCATGGACTATCGCATCGGCGTGGAGATC 7.04
CTTCGAATGCCGCGACGCCGCCACCAACCTGGTGCCCTGGGGCATCCTCATCGGCGGCGAAGAGCTGCACAACAACCACCACACCTACCCGAACTCG 7.02
GGCAGCCTGGGCTACGCGATGATGGCTTCGGCGACGCTCGGCGATGCCTTGTGCCTGGCGCTGCGCTACATGCCGCTGCTGCAGGGCAACGTCGAAA 7.01
TCCTCCATGCGCACGCCGCGCATCAATTGCACGGCGGTATCGCGGTAATACGGCACCAGCACGTCCTCGGCGCGCATCTGGCTGCCGATGGCCACGC 7.0
CTGCGGGTGGATGCGGTGGCCTCGATGCTCTATCGCGACTATTCGCGCAAGGAAGGCGAATGGCTGCCGAACCGCCATGGCGGCCGGGAGAACCTGG 6.96
GCCGCGGCTACGGCGTGCAGGGGCGCTTCGCCACCGTGATGGCCTACCCGCATGCCTTCGGCACCAACAAGCAGGCACCGTTCTTCGCCAACCCGCG 6.95
GACGCACTGCTGTCGGAATACCTGCACCAGTGGCTGGCGGCCGGCTACCAGGTGGCGATCACCGCCGATCACGGAATGAACGAGGACCGCAGCCACG 6.93
CAGCAGCATGCAGGGCAGCAGACGCTTGAGCTCAGTGACGGCGATCTGCCGCCGCGCCGGCAGCCAGTTGCCGAACGACGCGCTGAAATCCAGCAGG 6.89
CGTTTCCGCCGTGGAGCCACTGCGAGTGGCCAACCGCTTCCACGCCGACCTCTACCGCTGGCACGTGCTCAGCGCCGACGGCGGTCCGGTGCTGGCC 6.73
ACCAGGCCGAGCGCTTCCCGGTGAACCAGGCGATCGTCTCCTATGGCCATGCGTTGGCCACCAGCCTGGAGGATCGCCAGCGCTTCGCCGGGGTCTT 6.73
CCTGGAAAGCCAGGGCATCGCCACGCGGATGATGGTCGATTGCAGTCACGCCAACAGCGGCAAGAACCCGCTGAACCAGCCCGGCGTCCTCGCCAGC 6.73
CGCTGCTTCTGTCGCAACCGGGCCGCCGCCATCGCCGTGCGGGTCGAAGAGCTGTTCCGCGAGACCTACGGGCAACTGCTTGGCGGCCAGCCAAGCC 6.71
CAGCTGACCATCCAGTAGCCGCGATAGATCATCACCTCGGTATTGAAATGATCGGGAATCGCCGCCGGATAGGGTGGAATCAGCGGCACGGTTTCCA 6.66
AAATTGATGCTGTCGTAGTCGCCTTTCTTCAGGCCGAACGCCAGCGGCTCGTAGGTGAACGGCTGGTCGAGGTAGACCAGCTTGCCGGCGCCGAACT 6.64
TCAACTGTCGCGGATGCTGGCGAAGGAACTGGTCGGCGAGCACATCAATGTCAATGTGATCGCTCCCGGACGCTTTCCGAGCCGCATGACCCGTCAC 6.64
CTGGCACGGCGAGACCTTCGACCTGCCAGCCGGCAGCGTGCCGCTCTATGGTTCGGCTGCCTGCGCCAACCAGGGCTTCATCTGGAACGAGCAGGCT 6.61
AAGCGCTCCGCGAGCCATGCAGATGGCCGGTGTGCGGCACGCCGACATCGACCTGGTGATGCTCTACGACGCCTTTACCATCAACACCCTGCTGTTC 6.61
GTGATGTACAACCTGGAGGAACGCGGTATCGAATACGACCTGCTGCCCTGGTGCCAGGAGCGCGGCATGCCGGTGATGGCCTACTGTCCGGTGGGGC 6.59
GGATGGGTACTGAGGGGTAGCGACTTGCCGTGGAGCATTGGCCATGACTCAGGGCACGAAGGTGGCGTTTCGGCACCGGGTGCACGGGGACTGCCTG 6.56
CCCTTCTCGCTGATCCTGCTATTGATGATGTGGGGCCTGCACAAGGCCTTCTACATGGAGTCGCAGCGCCAGCGGGCGCGGAGCCACTCCCTGGCGC 6.44
GTGTCTGGGTCATGTTTGCCGTTCCGTTTTTATGGCCTTCCGATAGCACAGTGATTTCAGACTAGATCAACTTTCAGTAGCCGCTGGGGCGCAGCGC 6.43
CGCCGAGCAACAGGCGCGCCACGCCGAGCGCCTCCAGGTGCGGCCAGAGCGCCATCACCAGGGTGGCCACCATCGACAGCAGCAGCGCGACGACGAT 6.32
CGCCATACCATCGCGGTCCTGGCCTTCGGCCTGCTGGCGGCCATCGCCGCGATGGTGGCCTTCGCCCTGTTCGGACAGGTTCCGGCGGTGGCGGTGG 6.29
GCGCTGATGTCCATGCACACGCAGAGCAGGCCGCTGGCGGCATGCTGCTCGTCCACCAGCGGCGTGACCTGGTTCTGCACCCACACCGTATCGCCGT 6.27
GGCGCGTGCTCGCGAGACGAGCCGCAGCCGAAGTTCTCCCGCGCCAGCAGTACGCTGGCGCCCTGGTAGCGCGGCTGGTTGAGGACGAAGTCCGGGT 6.24
GCCGACTACGGCTTCTGCCTGTCGCTCGGCGAGTGGCAACGCGACGTCAACGCGGTGGGCGTGGCCTTGCACCATGAGAGCCATGGGCTACTGGCGT 6.11
TGGAACGACTACATCGCCGAGGACACGCTGAAACGCTTCGAGCAGCAATGTGGCTGCGAGCTGGTGCAGGAGTTCTATTCCGGCACCGAGGAAATGA 6.1
ATCTCGCGCCGCTCCATGTAGCGCTTGATCTCGCCATAGCCGTGGTTGTTCCACAGCAGCACGACGATGCCGACCTTGGCTTCCACCGCGCTGGCCA 6.08
GCACTTCAGGATGTTTCCTGGCGTAGTCGCTGGAGGCGAGGTAGTAGCGCTGGTAGCTGGCCAGGCCCTGGCCGTCGGCCAGTACCCGCGCGCGTTG 6.05
GTCATCGCGCCGCCGAAGCCGACGCCGAGCAGCACCAGGCTGGCCAGTTGCGCTCCGGTGGCGGACTGGTAGGACAGGGCCAGGCCGAGCAATCCGG 6.05
CTATTCACTCCAGGAGCGTTTCAATGAGCCGCACACTCGCCACCGTGATGCTAGCCGGGGGGCTACTGGCCGCAGGCCAGGCTGTCGCCGAAGACCA 6.03
ATCGAAAACCGTCGGGCTCGCAATCAGCGCGATTTTGGGCTCAGATTATCTGTGACTGACGGTGGGGGCGGGCTCACATTAATTGCGAGCGAGCTTG 6.01
GCCGGGCATCAGCCCGGCGTTTTCGTTTCCGCCTCGCTCAGCCGCGCTGGCGTTTCGGCAGCACGTCCTTGAGCTTGGCGTGCATGCTGCGGATGCT 5.97
TGCGCCGATGGTTGGTATCGCCTCGGCACGCCGCATGCCCTATTGTCTGGTAACGGGTGATGGCTTTTTGACTCATCGCTGCAGAGGCGCCAGGGTA 5.95
ATAGTGACGATGAGCTGGCCGGCACAACGCGAAACGAGCTCGTCACGATACCGACTCGGCATCGCGAGGCGCCCTTTGGCGTCGAGACTTATGGCAT 5.94
TAGCTTCCCGGCAACAGGATGTCCCGGCCGACCTCGCGGATGTCGGTATGGCCGCAGAAGGCCATGGTCAGGTCCAGCTCGCGGGCTATGATCTCCA 5.91
GCACCTACGGCGCCCTCAAGCTGGTGCACGCCGATGGCGGCGAACTGAAGCTGCAGGGCCATACCCTCGACGACACCCACCAGCGCTACACCCAACT 5.9
GTCAGCCCGGATATCCTGGAAACGACCTGCGCATATCTCTCCTGGCCATTATCGTGCCACTACCTTGCCCGGCCGCTCAGGTTCGGCGAAAAACGCG 5.89
GGCCAGCAGGTCCTGGTATTCCTCAATCGCCGCGGCTTCGCTCCGACCCTGCTTTGCCACGACTGCGGCTGGATCAGCCAATGCCCGCGCTGCGACG 5.76
GAAGGCCAGGCCGATGAACAGCAGCACCACGCCGATGCGCAATACCGTGTTGCCGCCGAACAGCCAGCCCTTGGCCGCGGCGAAGCCACGCTCGACC 5.72
GGTCGCCGATCATCAGGCAATGCTCCGCTGCCAGGCCTTCGCTGTCGAGCAGATGGCGGATCAGTTCCTCCTTGTGCGTGCGCGTGCCGTCCAGCTC 5.68
TTTCGGCCTCTGGTCGGCAACTGCCTCAGCAACATCACAACAATGCCAATCGGCTGTGGGAGTGTTCCATGTTCAAGTCCTTGCACCAGTACGCACA 5.66
CGCCAAACTGCTCGACATCACCCTGACCGCACGCGGCCAGTCCGGCGGCAAGGCGATCCCGATGGCAGGCATTCCCTTCCATTCGGCGGAGGGCTAC 5.59
ACCGCGGCGCTGGCGTCGTAGACCCCGCCGTCCATGGCGTACACCGGTTTGCCATCGATCTGCCAGGCGATGGTGGCGAGCAGGCCTGTCTCCGGCG 5.58
GCTCGTGGCAGGCCGCCAATGGCGTCTCGATGCCGAAGTGCTGGAACAGCCGGATCGAATGGCGGGTATCCTCCGCAGCCACCAGGGCCACCTCCCG 5.54
GAAGACCCGCGATGGTGGCAGCGAGGAGATCGCCGTGGATGGCATGTTCGTCGCCATCGGCCATACTCCCAATACCTCGCTGTTCGAAGGGCAACTG 5.53
CGCAGGCCCGGTCGAACTCGTTACTGTATTCGTGGCAACCGTAGAGCAGTTCGATACTGAACTGGCGCATCGGAGCCGGCAACGGCAGGGTTCCCAG 5.52
AACAGCGGGACGGTGGCCAGGGACAGTACGCGGTAGTAGCCCTGTGCTTCCATCTCCGGCACTTCGCTGGCTTCCTCGGGGTTGGCCGGATCGCGGC 5.5
TTCATCGCCGGCGCGCTGCTCGGCGGTATCCTCCTGCTGACCCGGCAATGGCGTCCGGCCATCTTCGCCATCGGCACCCTGGTGGGTACCGCGCTGG 5.46
AGCAGCTTGGCCAGGTTGGCGACGATCCGTCCTCCCGTGGCGGCGAACGGGTGGCCGGCGGCCAGTGAGCTGCCCTTGACGTTGAGCTTGCTGCGGT 5.46
ATCTCGTCGCAATGCACGTCCACCGGCAGGTCGTAGCGCTTGGCCAGGTCGATGGCCTTGTGCAGCGACTCGACGCCCAGCTCGCGGGTGAATTCGA 5.45
GGCAGGCGGTGCGGTACGCGTCCTTGCAACTCGGGAGACGTGTACCACAAGGCCATCAATTGGCCACATATCTTTGGTTGGGCTCGAAACCGATGAC 5.42
TCCTTTCGAGGCCAGGATTACGGAAAAATGAGCGCAGTGCTGGCGAATTAGCGTCAGGTAGCATACTCAGGCACTGAGAACAGGAGTAAATTCTCCT 5.41
GCGAAGATTAATGAATTCCTGTGGCGAGTGCCATCATTTCGTCGCTAAAAAGTTGGCATGTTGAGGGATTTGCCGATCCGGACACGCGCGGGGAAGG 5.39
GTTGCGAGGACTACTTTTGGCTTGATGTCATTCAACTGGCCTTTTGCCTGCAACCGCTCAGCGCTGGGCCACCGGCTCCATTTCGTGGCCGCAGGCC 5.35
GCGGTGTGCGAACCGGGCGATATCGTCGCGGTGGAGTCGCCGAGCTTCCATGGCGCCATGCAATCGCTGAAAGGCCTCGGCATGAAGGCCCTGGAGA 5.35
TCGGCCTCGGTGAGGCTCCACACCAGTTGCTGGCGCACGGTCAGCACATGGCCATCGGCGTCCGCCTCGGTGACGAAGGCGTGCGGCACGGTCGGCG 5.33
CGCACCGGCATACCGATCATCGACGCGGCAATGCGCCAGTTGCTCGCCACCGGCTGGATGCACAATCGCCTGCGGATGGTGGTAGCGATGTTCCTCA 5.32
GCCTCGGCATGATGCTGGCGGTCGGCCTGATGATCGCCGCGATCTTCAACCTGGCGCTGACCCTGCTGGCGTTCCGCTGGCTGCTCAAGCCGGCGCT 5.3
TGCAAGCCGTGGCACCGCGCGCCGAGGGCCATGCGCTGGGCTGGTGCAGGCAATGGAGCATCCTCAGGCCACTGATCGCCAAGGGTGCCTGGAACGG 5.21
ACCTGGCTGGTCAGGGCATTCTGCACCAGCATGATGCCCTCGCCTTCCTGCGGTCCGGCCAGCAGGATGATGGCGGCGGAAGCGGTACAGATCAGCA 5.19
GCGATCAAGCCGATGCTCAAGGATGGCCGGGTGCTGGCCACTGCCGACCAGTTCGCCGCGAAGCAGGCGGTGTTCGGTATCCAGACCGCGCTCAAGC 5.15
GAAGTGATCCTGATGCTCAAGGCCAGCGCGGTGGTCTACACCGTGACCCTGTTCGACATCATGGGCATGGCCCGGACCATCATCGCCCGCACCTACG 5.12
GCAGCGACATCAAAGGCGACAGCCTGCTCGTCGGCTACGAAAACAAGATCGAAATCATGTCCTACAGCCACAACGTGGCGATGCAGGTCACCAACGA 5.12
AGCGCCGACATGCTGATGATGCCGATGCCCTGAGGGCCATGACGTGAAGCTGAAACGCTATCTCCTGGTGGCCAAGCCGGGAATCATCTTCGGCAAC 5.1
GGTGGCGACTTCGCCACTGGCGGCGCGGGAACGGGTCATCGGCGGCATGACGATGCGATTGGGGAGGGTCAGGTGGCCAAGGGTATAGGGGCTGAAC 5.1
CCAGGCGCCCATCCTGGATATCGCGGTCGGTCATGAAGCTGGCCAGGCAGGCGATGCCCTGGTGGCTCAGGGCCAGTTGGCGGAGCGTCTCGCCGCT 5.04
CCACTATCGTGGCCAGCCCTACGGCTACGCCTACGAAGTGCCGCGCTATCGCGTGTATGACGATGGCTGGCGCAGCGAACGGCGCTACTACTCGACG 5.0
TCACCAGCTTGGCCAGGTAGTCGCGCCGCAACGCCTCGTCGCCATGCTTGTACAGGGCCAGCACGGCGCCCTCGGTCAGCCCCGAATAGACGCGGAA 4.95
GGCAATGGTCTTCGAGGGCATGCAGGGTGCCGTCGGTATCGCGCCAGACGGCCAGCTTGTAGCCCAGGCGGCGCAGGGACACCGGCTTGTCCTCGAT 4.91
CGCCGCACCCCCTGGCTCTTCTGGTGCTGGCCAAGGTGCTGGCACACTGGCTGTTTTCCGGGCTGGCCCTGGTCCTGATGTCGCCGCTGTTCGCGCT 4.9
GCGCGATTGCCCCATGCCCAGGTAGTCGAAGGTGATGGCCAGGTAGCCGCGCTCTGCCAGCCAGGCGGCGAAGGGCGCGTAGAACCGCTGTTCCACG 4.9
GGGCCAGCCATTCCAGGCCTTCGGCCACGCTATAGAACGATCCGAACAGCAGAATGACATCATCCGCGGTAGCCTTGGCGCACTGCGCGTCCAGGGC 4.82
GCTTGGCGATGGAGACCTCGGTGGACTTGACGAAGGCGATCACTTCGCTACCGATGGCCAGCTCCAGTTCCTTCACCGAACGCGTGGTGATCACCGA 4.82
TGGGCCATCACGGTCCCTACGTCTGGTCGGCCTACGGCATCAGCCTGCTGGTGCTGGCGATCAATGTCGCCGAGCCGCTGCTGGCCCGGCGCCGCTA 4.82
TCCGCGTCCGGTTTGTAGAAGGTGTAGGGATGGCGGACAGCGATCGCACTGGCGTCCACCAAGGTCCACGAGGCCATGTCGACTCCCGCTTGGCTGG 4.79
GTGTCTGTTCTGCAACTGTCTATAGACCGCCGGGGGATGGGTGTCAAAGTGCCACTTCGCAGCCTTCCGCATGGTGGATGGCTGCGAAGGAGAGTCG 4.78
TGCTGTCGCGCTGCAACTGGACGCCGTTCCGCCACCGGGCATTCCACCATCGGATCGATACCACCATCGTCTCCGGGCAACTCGCCTGGCACGCGGG 4.69
GGACATGCCCTGGCTGCTGCAGTGCGCGCAGATGGCTGCCATCCACGATGACATCCAGGCCATGCCGATGGGCTACAACACCCTGGTCGGCGACATG 4.69
TCGACGCCATCTCGCGAGTGGTCGGCTTCCTGCTGGTGGCGATGGGCGTGCAGTTCGTCATCAACGGCGGCTTCGAGCTGGTCGCCGGCCACGCCGC 4.68
CCCGCGACCCGCGCCACATCAAGCCGGTCCACGTGCTGATGGCGATGATGGCGATCCGCGGCATCTACCAGCGGCACAACGTGCAGTCGCTGAACCA 4.67
GGCAGCCTGCGGCAGACGGTAGTAACCGGCGATCTCATGGCATACACCGAGCACTGCGCCATAAAGGTGGAACAGCGCCGACTCGCGCTCCCCCTGG 4.65
GGACTCCGGCCTGGCGCGGATCGATGCGGTTGCGCTGGTGGTAGCGCCACAACGCCAGCACCACGTTCGGTACCACCATCACCAGCGCGGTACCCTG 4.64
ACCCTGAAGGCCATGCCGCCGAAGCTGCTGGCCGACGACGGGCGCAACGTGGTGATCCGGCCGCTGGCCTATTGCAGCGAGAAGGACATCGAGGCCT 4.63
GGGCGGCAAGGCGTGGGGCATGGAAACTCTCCGTCAGTGATAGCGAAGTGAGGGGGGCGGAGCGAGGAACTCGGGTCGGACCTCCGCGTTCGGCGGT 4.63
TCAGCTCGCTGTTGGGACGCTCGCGCTGTTGCTGCGCCAGCCATTCGCTGGCGTCGTGGTCCGGCAGCAGGTCGATTTCCAGGGTATCGCCCGGTTG 4.6
CCGCTCAGGCAGCAGATGGCAGAGAGGGGTGGGGCGTTCGGCCATCAATACAGCATGGGTTTCGTCCTCGATGACGATCAAGCCGTGCTCGCGGCAG 4.6
TGGTACGGGACATGCTGGGCATCGGTGGTGGCGTGAGGGCTTCATTCTAGCTCACGGCCGGTACCAGAGTGCCTCGCGCTGAAAAGGAGTTTTTCCT 4.57
CGGCACATCGTAGGGATTGCGAAAACGGTGCGGCTTGTTGCTCTCAAAATAGTAGCTGTCGCCGCGCTCGAGCACATAGGTCTCGCTGCCGACGGTC 4.55
CGATCTGCACCTGCCAGGCGTTTTCGATACCCGGCACGGGTGCCAGCGAATCGGCATCGGCCAGGAACACGTCAAGCTCGGCAGGGTCGTCGCCCTT 4.53
CAAGGTGGTCATCGATGAGAGTGTCATCGATGGCTCGTCGCAACCCCTGATGATCTACGAGAACAGCGAAAAGCCAGCCAAGGCTGCGCCTGAGGCA 4.52
TGTGCGGCGAATATTACCGGATGTGCCGGGAAAGAAAGCCGTTCGGTGTCAAATCAATGGCGCAATTGCCGGAGATGGAAGCGCTTTGCGTCTTGTC 4.48
GGGGATCAGGCAGATGTCGCGCTGGCTATCGCCGCGGCTCTGGTGGTAGCGGCGGATCGCCAGCAACCCGGCATATTCGCCCTGTGCTCCCGAGTTC 4.46
GATCTTGGTCGAACCGGTGAACACCAGGGTGTCGACATCCATGTGCAATGCCAGCGCCTTGCCTACCGTGTGGCCATAGCCCGGCAGCACGTTGAAC 4.45
CCTACGCCCGCCTGTACGGCTGCGACGATACCACGGTGTACATGCAGCACAGCGCCAGCGGCGAGGCGATGCTGTTCGAGGAGGTCGATACCCTGGT 4.45
TGGTCATCGGCCAGCATTTCCACCTGGACCTTGGGAAACTGCCGGATGAACGCCGCGGAAACGCTGCTGATGTGCCACTTGACGAAGTCCTGCGGCG 4.38
TTTTTCGAGGAGAAGCGGAGGCAGGGAGACTGCAGGGTTGCAGCTCGGAAGGGTCGTTCGTGGATCGTTCTGATGCACCCATGCTCGCACCGCCTGT 4.34
GATGGCAATCCCGCCCCCGACGTCTCGCACTCCACAGTGCGCGATCATTTCGTCCTGCTGGCCAAGAACCAGCGCCGTGCCCAGCCGGTTTCCGCCG 4.34
TCGAAGGTGGCGTAGATCAGCGCGGCCAGCATGTTGCACAGCAACAGCAGGGTGAAGGCGCGATGCCGGCCCATGCTCAGGCAGGCTTCGAGGAACC 4.32
CAAAAGCCGGTGGAATGCCCGTAGTGCTTTTCTGCCAGTTTCTACGGAAAGGGCTGGGGATTCGCCAGCGTACGCAGTAGCATTGCGCCTTTCCTGT 4.31
GCTTGAGGCTCTCGACCACCTGCTCCTGGCTGATCACGCCGTGACGCAGCCAGTTGGCCAGCAGTTGGCTGGAGATGCGCAGGGTGGCGCGGTCTTC 4.3
TGTTACTTCTGCGCTAGGTTCCGTACGCAAAGTAATGTCGTAAGCACCGTAGCGTGCAAGCCAGCGTGACCATTACGCCAAGATTCTTGACGAGCTT 4.27
GAGCGGCCGCCGGCGGCGCTGCTCGACGCACTGGAACGGCGCTTCGGCTTCGAAGTGCCACGCCACAACGGGCACAACGCCGTCGAGGCGATCGCCG 4.26
GCAGAAGTACCTGACCCTGGCCAACATCCAGTACTCCGACCAGTTCCTGGTGGCCAACGGCGATCTGCTCGCCAGCCTCCCGGCAAAGGAGCGCCAG 4.25
CTCCTCATAGGCCGCGGCCAGCTTGTGGTGGCTCTCGAAGGCCAGCCTGTCCTGCTCGTCGCGGGGAATCTGCCAGGTCTGCGCCATCAGTTCGCAG 4.24
TGTCGATGGAGGCGAAACGGCCGAAACCGATGCTCGATCCGCTGCTCTTCTGCAGGCGTTTCAGCTCCCCGCTCAACGCCGGGCGGTCGAAGAATTC 4.22
ACGCACTTTTTGCTATTGCTGAGGTGCTTTGGCAATTATATAAAGCCATCCGTTGGTGCCTGTGTGGCCACTTCATGTAGTGGCTGGGCGTCAATTC 4.21
GGAAGATCGAGACGGCCATCGGCCTGTCCCTCGCCACCACCTTCGTCCTGACCCTGGCGGCGATGTGCAGCCATATCCTGCAACGCTACGTGCTGCG 4.21
GAAATGCCCAGGCGCGCGGCGCGCCGCCAGCCGTCGCCCATGCTGTCGTTGTGCCAGGTCCGAGTGGAAATACCGGGCTAAAGCCTTCCGGCTTTTT 4.2
GCGGGCAACTGCCGGAATACAGCCTGGCGATCTGGCACGGTTTCAACCTGCCATTGCTGATGAGCGTGGTGGCGCTGGTTGGCGGTGTGCTGGTCTA 4.18
GGCACGGATGCGGCGCTTGCGTTGCAGGGCTGGCGTATTGAAGTCAATCCGCTCGGGAGCAAGGGAGGAGTTCATCGGGGAGTTGGCCATGTCGTTC 4.17
TCCTTGGCCAGCTTGATCGCGAGGTTGGACAGCAGCAGGATGGCGATCAGGTTGGTGATCGCCATCAGGCCCATCGACACGTCGGCAAGGTTCCAGA 4.15
CGATCAATGGGCCTATCAGCGCGACATCAAGCTGAAGCTGATTCAGCCTGGTAAGCCCACGCAGAATGCCTTCATCGAGTCGTTCAACGGTAAGTTC 4.14
ACCAGCGCGAAGCAACGGCGTTTCCATTGATGGCGATGCGCGGCCAACTCGAAACCGCAGCGCGGACAATTGGCTTTCTCGCCCGGTCCCAGGGGTT 4.13
GCGTGGGCAAGACCACCACCATCGGCAAGCTGGCGAAGAAGCTGCAACTCGAGGGCAAGAAGGTCATGCTGGCCGCCGGCGACACCTTCCGCGCCGC 4.08
CCAATTGCACCGGTCCCTCTTCCCATTTCACGCTGACGAAGGCGCTGAGCGGTACCAGGTTGCCAGCAGCGTTAGGCACGTATAGCTCGAGCACGCT 4.08
AAATCTGGTTACAACTGGGTTTCAGGCGAAACATTCGGTCATGGCAATTCGGCATTAGTTGAAACTTTGGAGACGCTCCGAAGCGGGCAACTTTTGC 4.06
TCTATGTATCCTGCAATCCGGCGACCCTGGCGCGCGATGCTGGCGAAATGGCCAGGCAGGGCTATCGTCTGAAGCGCGCCGGAATCCTCGATATGTT 4.06
CTCCCCGGACACCGTGGCAAAGCGCGACACATGTCACATTTCTCCAGATAGAGGCCTAGTGCCAGCAGAAAGCCCTTCGACGCGCCGGCATGGCCCT 4.05
TGCAGGTCGACGTTCTTGCTCACCTTGTAGCTGGCCATGGCGTCATAGCGCCAGTAGGACGGGATATAGGTAGAGTTCGCAGTGTTGCCGTACTGCT 4.02
GGCCAGGTGCGCCGGGCGGATCGGATCGTTGTAGATGGCGTAGCGATAGCGCCGGGCCATGGCCGAGAAGCGCGCGTGGAAATGCGCCGGCATCACC 4.02
GGTTCATGACGACATCGTAGGTTTCGCCGCCTTCATGGCGCTTCGCCCAGATCGCCAGCTCCTCCAGGGCCATGCCGAGGGCACTCTGGTTCTGGTT 4.01
CTGACCGATCCCCACGCGCTGGAAGCGATGCGCCTGATCGATGGCAATCTGGTACAGATGATCGCCAATCCCGGCGACATCGCCCTGCGCGAGAAGA 4.0
CACCAGGGTATCGTCGGCGGCCATGATGGCGTTCTTGTAGGCCATGAAGTGCTTGAAGCTGTTCACCCCGTGCTGTGCCACCAGCTCGCCCATTTCC 3.97
CCACCAGGGTCTTCAATGGCGGGTTGCGGCTCATGCCGATGAAGGTGCAGAACGCCAGCAGGTAGACGGCGAAGAACTCGGGCGAGCTGAACGCCAG 3.94
CGCTGGCGTCGGCCAGCTGCGGGCCCATCATGGCGATGTACATCCAACTGATCGGCAGGATGCTGGCGCTGCCCCAGGGCGTCGCGCTGACCGCGTC 3.86
GCATGATCGGCTACATGATCGAACAGGAAATGGGCAACCTGCTGCCGTTCGAAGTGCCGTTCGCCACCATCCTCACCCAGGTCGAGGTGGACGGTAA 3.82
CCTGAGGGCGAAGTGTTTAGAAAGTTAATGCGCTTTACTCTCAAATAACAATCAATATCATTTGTGATCTCTTGCATTTCGCTGCATTGCCCGGAGA 3.82
CCTGCGGCTCGGTCAGGCTGGGATCGGCGTAACGCAGGTTGCGTCCGCTGGCGAACAGCCAGAGGAAGGCCAGTTGGCAAGCCACCACCAGGGTGGT 3.82
CACACCGCCGCGCTGTCCACCGACAACCTGGCCAAGGGCTACTTCGCCGACGAAGGCATGCTGGCCTACGTGAAGGGCGTGCAGCGCCAGGAACTGC 3.8
TCAAGAAACTGGTGGCCGCGGAAAATGCGAAAAAGCCATTGAGCGACAGCAAGATCGCTGGTTTACTGGAGGCACAGGGCATTCAAGTGGCTCGCCG 3.73
CCACCACGATCGCGGCCGACAGCACCCAGGTCAGCAGCATCGACACCAGGACGGCGCCACGATGATCGCGGACCACCGCTTTCAACGGCACTTCCTC 3.72
ACCCGAATCGAGCATCACCGCACCGGGCGCCTCATGGATGATGGCAAAGAGACAGCTTGGGTCGCTATGGTAGGGCAGGGGGTGAACATGACAACTG 3.71
CGCCGGCGCACCTGATCGCCCTCGGCGACCAGTCGCGAGTCAATCACTTTGGTGTCATGGGCACCGCAGAAGGGACAATGCATGGTGCTGATACAGG 3.7
CGGGCTCGACCCTCGCCGACGACTCCCTGGGCCATCGCGACAACATCAGCACCGGCCTGAACCAGCGGCAGAAAGCCGAAATGAAGGTGCCGCCGGG 3.69
GGGCGGTATATCACCCTCATATCGTGGTGCGTCTCCCTCCTATTGCAGTGGATTGTCGAGAAGGCATTGCCGGGCTGGGAATCGGGCGGTAAAAAGT 3.68
TCCGGCCGGGAGTTAAAAAACCGGCCGCGAGCCCATCAGAACGACAACACCGGGCCACGCCATGCGTATCAAAGTGCACTGCCAGAACCGTGTAGGC 3.64
GAACAGGAACGATGCGTGGCATTTTGCGTATGACCGTGCTGGCTGCCGCAGTGTTCGGGGTGGCCGGCAATGCGCTGGCCGAAGACTGGAAGCTGGC 3.61
TCGCGATGGACAGGCGCCATCAAGGAGTCGTGCGCGATGCTCTTCGGCAGAAAAAGCAGGGCGGTGGAAAGCGCCGCCAAGGATGAAGACCTGGCGT 3.61
CACCGGCGCTTCCCAGTGGCGCTGGTTGGACATGTTGATGGCGAACTCGGCGGTGCTTTCCGGCACGCTGATGTTGTCGTGGGTGAGGACGAAGCTG 3.6
TGCAATTCATCTTGGAGATTGATGAATGAGCTACCAGCCCGGCATCGATACGGAATTGCTCCGCACCTTCGTCGCCATAGCCGAGCACGGTGGTTTC 3.58
TCGTTGCTCTCGTGCGCCCTGACGAAGAAGGTGGCATCGCGCGCCAGCTTCGCCAGCAACTCGTCGCCCATCTCGATGGTGTAGATCGGCGACATGT 3.58
ACTACGTCAAGGTCGTACGCCTGGTGCCGGCCGGCCCGGCGGCGAAGAGCAAGCAGATCGCCACCTCCGACAAGATCATCGGCGTCGCCCAGGGCAA 3.55
GCCCGGCCAGTCACACCTATTGATAGAAGTAGGTAGCCTACTGGCAACGAACTGCTATGATCCCTCGGCGATCTTCAGACATAACGATAAAGACCAG 3.52
ATAATGGCCACGTGGCGTGGCACGCACACATCCTTCCGGGTCTTTTCCATGACGTCAGCCCGGCCTCAGACAGCCATGAGGTCCGCTTCTTTGGCTT 3.51
CATCGACCGCGACAGCACCTCGCGCAAGCACGCCATGCGCGACCTCTTCGCCACCATCAACAGCGGTGAGCCATGCATCCTGGTCGGCACCCAGATG 3.51
GGGCAGTTTCATCACGAGATGCCATGAATTTCATCCTTTACTCGGATATCAACGAGCGCTCGATCGGCCACAACCTCGGTCGCCCCGAATACAGCTA 3.46
TGTGGTTGACGATGTGCAGCATCGCCGTCACCAGGATGAAGGCACCGTAGAACCAGTTGCCCACATAGATGTGCTTGACCTTGCGCTTGACGATGGT 3.45
AAAAGCGCATGCCCACCGGGCGGCATGCGGTCATCGGGGTGCCGTTCCTGTGGCTCTTCCTGTTCTTCCTGCTGCCCTTCGCCATCGTGCTGAAGAT 3.45
CGCGGATGGTAGCGAACGACTGGCGATAGATCGCCTGGCCATCGCGGATGTAGTCAATCATGCGGGTTTTCCGGAAGTGGGCTGGGAAGGCAGGGCC 3.45
CCCAGCAACAGACTGCGGGCGTTCTGCCCGCCGCCCTGGGCAAAGAGATCATAGTACTGGCGAGCCGGCACGTACTCGCGCTCCTTGTAGAGCAGGT 3.44
CCGGAGATCGGCTACCACCACCGCGGCGCCGAGAAGATGGCCGAGCGCCAGTCCTGGCACAGTTTCATCCCCTACACCGACCGCATCGACTACCTCG 3.44
CGCGCGCAGGGTCGGCCTGGCAAAACGGCGTTGTTATACTCGCCCGCACATTCACCGCTGCCAGTACAAAGGATTCGTCCATGAAAGCATTCGGCAA 3.42
GACCAGCGGCTTGCCGCTCTTGATGTCGATCACCCGGATGCTGGCGAAGTAGCCGCTGTCGAAGATCGAGCTGACCATCAGTTGCACCATCGCCGGG 3.41
CGCGCCCATGTTAAACTCGCCGCCGATTTTTCATGCGGACGCATCATGGCCAAACGCCACTTGACCCGCCGGCAGAGCTGGCGCATCGAAAAGATCC 3.33
CAGTGACTCAAGGTCGCGGCATCCTGCCGCACCGCCAATCATCGCAAAAAGCCAGCGGCAAAGGCCATTCATTGCACAATCAATGACCTGGGCCGTG 3.32
GATATCTACGATTCCTTCCTTTCGGAAGAGGCCGTGCTGGCGTTCGAATACGGTTTCGCCACCACCACGCCGAACTCGCTGGTGATCTGGGAAGCCC 3.29
GCGAAGTCGACGCGCGCTATGCGGTGGATGCGGATGCGGTGGTGGCGATCTGGGGCATGGAGAGCAACTACGGTTCGCACATGGGCAACAAGAACGT 3.29
TTCTTCAGGCCGCGGGACGGATGAGTACCGATGCCAACGACCTCCAGCTGGCCATCGGCCGTCACCTCGCCCACCAGCGCCACCACCTTGGAGGTAC 3.28
GCGGCAAGCTCTGGGGACTGTTCTCCTGCCATCACATGTCGCCCAAACTGATTCCCTACCCGGTGCGCATGTCGTTCCAGATCTTCTCCCAGGTCTG 3.24
GCGCTGTCCTACGACGTCTCGCTGGCGACTTCGTACCAGATGGCCTACACGCTGAAGAACCGCTACCACACCACTGCCGGTACGTTCGAGTCGTCCG 3.15
AGATCACCGAGACGATGCCCACGCCCTCGCTCTTGAGGCGTTCCGCCAGCGGGAAGAAATCGGCGTGCCAGGAGGAGTCCAGCAAGACCAGTTGGTC 3.11
CACAAAGGATAACCGGCAAATGCCACTTCAGCACGACACCAACGTGCCATCATGCGTGACTCGATAGCTCTGCCGAATTTTATCGCCTCATAACAAA 3.08
CTCTCCAGTTCTTGAGACGTTTGTTTCAAGATAGCGATTTGCGCCTTATAGATATCAGCGCTGTACGCTTTGGCCAGCTCACTCATATGTCGATCAA 3.04
GGCCCTCTTTATCGAAGGAGAGGGCCAGATAACACTAGATCGCTGCAAAATAGGCCAGCAGCAAGGTTACTGCGGTCGTATAGCGGAGACCCGATTT 3.04

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
CCTATCGCCATGA PA4842,
... ... PA4842 PA4841 PA4843 PA4844
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CTCTATGCTATCA PA4842,
... ... PA4842 PA4841 PA4843 PA4844
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CATAGAGCCATCA PA4842,
... ... PA4842 PA4841 PA4843 PA4844
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAGGCGCCATTA PA2867,
... ... PA2867 PA2868 PA2869 PA2870
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGCCTTGCCATTA PA2867,
... ... PA2867 PA2868 PA2869 PA2870
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGAACGCCACCT PA3691,
... ... PA3691 lptF
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CCTTTTGCCAGCA PA5138,
... ... PA5138 PA5137
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGCTTGGCCACCA PA3235,
... ... PA3235 PA3234 PA3233 PA3232 PA3231
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGGATTGGTATCA PA3235,
... ... PA3235 PA3234 PA3233 PA3232 PA3231
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGGCTGCCATCC PA4222,
... ... PA4222 PA4223 fptA PA4220
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGATCGATATCG PA4222,
... ... PA4222 PA4223 fptA PA4220
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGAAGGCCAGCC PA4677,
... ... PA4677 PA4676
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAACTAGCTATCA PA4677,
... ... PA4677 PA4676
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CTAGTTGCCGGCA PA4677,
... ... PA4677 PA4676
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CACAAAGCCATGA fleQ,
... ... fleQ fleS fleR
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
TATTTCGCCATTA PA0172,
... ... PA0172 PA0171 PA0170 PA0169
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CTGCTCGCCATCA PA0172,
... ... PA0172 PA0171 PA0170 PA0169
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
TCATTCGCCATCA PA5167,
... ... PA5167 PA5166 PA5168 PA5169
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CCGTTCGCCATCC PA5167,
... ... PA5167 PA5168 PA5169
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CCGATCGCCAGTA PA1657,
... ... PA1657 PA1658 PA1659
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAATCGCCAGCG PA0038
... ... PA0038
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CATATTGCCATTA PA3722
... ... PA3722
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAATATGCCAACG PA1941
... ... PA1941
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGCTTGCCAATA PA1941
... ... PA1941
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAGCTGCTATCA PA1941
... ... PA1941
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
TCCAGCGCCATCA PA4324
... ... PA4324
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGAAATGCCATTA PA4324
... ... PA4324
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CATTTCGCTATGA PA4324
... ... PA4324
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAAGCGCTATCA PA1680, PA1679,
... ... PA1680 PA1679 aroC PA1682 PA1683 PA1684 masA
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CATTATGCTATCG PA0938
... ... PA0938
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGGTTGCCATCA PA2462,
... ... PA2462 PA2461
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGTGTGCCAGCG PA2462,
... ... PA2462 PA2461
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CACAGTGCCATTA pctC
... ... pctC
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CATCTGGCTATCA PA4683,
... ... PA4683 PA4684 PA4685 PA4686 hitA hitB
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAAACGCCATCA flp,
... ... flp rcpC rcpA tadZ tadA tadB tadC tadD PA4298 tadG
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGCTCGCCGCCG flgE,
... ... flgE flgD
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAAAGGCCATTA PA4844,
... ... PA4844 PA4843 PA4842 PA4841
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CCTTTTGTCATCA PA4844
... ... PA4844
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGTGGGCCACCA PA3951,
... ... PA3951 PA3950
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAATGCGCCAGCA PA3413,
... ... PA3413 PA3412 PA3411 PA3410 PA3409 PA3414
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
TCAATGGCCATCA PA1331
... ... PA1331
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
GAACTTGCCATCG PA1664,
... ... PA1664 PA1663 PA1665 PA1666 PA1667 PA1668 PA1669 stp1 stk1
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGTTTCCCATCG PA1664,
... ... PA1664 PA1663 PA1665 PA1666 PA1667 PA1668 PA1669 stp1 stk1
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAATAGCCATTA PA4033,
... ... PA4033 PA4032
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGAATCGCGATCC PA0494,
... ... PA0494 PA0495 PA0496
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CACAGTGCTATCA PA3353
... ... PA3353
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGAAAGGCCACTA PA4520
... ... PA4520
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CACAATGACATCA PA2567,
... ... PA2567 PA2566 PA2565 PA2564
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGTTCGCCGCCA PA3401,
... ... PA3401 PA3400 PA3399
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
ACGATCGCCATCA fliF, fliG,
... ... fliF fliG PA1103 fliI fliJ
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CTGGTCGCCACCA fliF, fliG,
... ... fliF fliG PA1103 fliI fliJ
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CTGTTCGCCAGCT PA4331,
... ... PA4331 PA4332 PA4330 PA4333
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGGTGGCCACGA PA3019,
... ... PA3019 PA3018 PA3020 PA3021
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CCCTTCGCTACCA PA1939,
... ... PA1939 PA1940
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGGATCGCCTCCA PA1668,
... ... PA1668 PA1667 PA1669 stp1 stk1
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGCATGCCATCG PA1668, PA1669,
... ... PA1668 PA1669 PA1667 stp1 stk1
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGTACGGCATCC PA1669,
... ... PA1669 PA1667 PA1668 stp1 stk1
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CTATTCGGCAGCA PA1738,
... ... PA1738 PA1739 PA1740
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGAATGGCCGGCA PA4639,
... ... PA4639 PA4638 mqoB
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAATAGCCATCA PA3921
... ... PA3921
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CACTTTGCTATCA PA2282,
... ... PA2282 PA2281 PA2283 PA2284 PA2285 PA2286 PA2287
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAATTGGCCATAC PA2894
... ... PA2894
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGTCTGCCGTCA PA2894
... ... PA2894
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGACTGCAACCA PA2894
... ... PA2894
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGAAGGCCAACG aer
... ... aer
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CACAATGCCACCC PA3311,
... ... PA3311 PA3310
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
GAGGTTGCCACCA PA0691,
... ... PA0691 PA0690
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGCACGCCATCG PA1107,
... ... PA1107 PA1106
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGCTGTGCCATCA PA1107
... ... PA1107
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CTTTCCGCCATCA PA4981,
... ... PA4981 PA4980 PA4979 PA4978 aruI aruH PA4975
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
ACGATGGCCAGCA PA4981,
... ... PA4981 PA4980 PA4979 PA4978 aruI aruH PA4975
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGAGTGCCGCCA roxR,
... ... roxR roxS PA4495
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAATTGCCATCA PA4929,
... ... PA4929 PA4928
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CATTTCGCCACCT PA4929,
... ... PA4929 PA4928
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAGTCGCCATCA pobA,
... ... pobA PA0246 aroQ2 PA0244 PA0248
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAATCTGCCATCG oprO
... ... oprO
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGATTGCAGCCA oprO
... ... oprO
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAATTTGGCTGCA oprO
... ... oprO
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CACCTCGGCATCG exoT,
... ... exoT PA0043 PA0045 PA0046
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CCGAGCGCCATCA exoT,
... ... exoT PA0043 PA0045 PA0046
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAGAGGCTATCA bifA
... ... bifA
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CCGACCGCCATCA tadC, tadG,
... ... tadC tadG tadD PA4298
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CACCTGGCCGGCA PA4392,
... ... PA4392 PA4391 PA4390 ampG
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGCTTGCCGCCG PA4392,
... ... PA4392 PA4391 PA4390 ampG
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CACAGCGCCATCA putP,
... ... putP putA PA0781
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
GCCATCGCCACCA PA3039,
... ... PA3039 PA3040 PA3041 PA3042 PA3043
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGCTTGCCGTCG PA3039,
... ... PA3039 PA3040 PA3041 PA3042 PA3043
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CCAAGCGCCATCA exoS,
... ... exoS PA3842 PA3843
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CACTTCGGCGTCA exoS,
... ... exoS PA3842 PA3843
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAATCGGCCAGCA PA0252
... ... PA0252
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGGCTTGCCGCCA pvdJ,
... ... pvdJ pvdD
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGCTCGACAGCG pscL
... ... pscL
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CCATGCGCCATCA PA1473,
... ... PA1473 PA1474 PA1472 PA1471 ccmA ccmB ccmC PA1478 ccmE ccmF ccmG ccmH cycH
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAAGCGTCATCG PA1873,
... ... PA1873 PA1872 PA1874 PA1875 PA1876 PA1877
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGCACGCGATCA PA0338
... ... PA0338
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CTGGTTGCCAGCG PA0338
... ... PA0338
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGCGCGCCAGCA
... ... trpI trpB trpA PA0038
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGAATCGGCGTCA PA3215,
... ... PA3215 PA3216
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
TTCATCGCCAGCA PA4606,
... ... PA4606 PA4605 PA4604 PA4603
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGATCGCCACCA foxA,
... ... foxA PA2465 PA2464
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAGGTAGCCATCG foxA,
... ... foxA PA2465 PA2464
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGCATCGCTATCG PA2992,
... ... PA2992 PA2993
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGAAAGGCCGCCA purU1,
... ... purU1 mvaT
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
TTCATCGCCATCA braD,
... ... braD braE braF braG
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
TACATCGCCTTCA braD,
... ... braD braE braF braG
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CAAATTGCTGCCG PA2461,
... ... PA2461 PA2462
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
GGAATTGGCATCA PA0264,
... ... PA0264 PA0263.1 gabD
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
TCGATGGCCACCA bkdB,
... ... bkdB bkdA2 lpdV
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CGGAAGGCTATCG PA3190,
... ... PA3190 PA3189 PA3188 PA3187 oprB
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CCCATTGGCATCA wbpZ,
... ... wbpZ wbpY
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CTGAAGGCCAGCA zipA,
... ... zipA PA1527 lig PA1530 ffs
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - repressor not specified
CATGGCGCCACCA ftsI,
... ... ftsI ftsL murE murF mraY murD ftsW murG murC ddlB ftsQ ftsA ftsZ PA4406.1 lpxC
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CCAGTCGCCATCG PA4488,
... ... PA4488 PA4489 PA4487
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CAGTTGGCGACCA surA,
... ... surA ostA pdxA ksgA PA0591 apaH PA0589 PA0596 PA0597 PA0598
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CAAACGGCCAGTA surA,
... ... surA ostA pdxA ksgA PA0591 apaH PA0589 PA0596 PA0597 PA0598
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CAGAGTGACACCA wzx,
... ... wzx hisH2 hisF2 wbpG wbpH wbpI wbpJ wbpK wbpL PA3144 PA3143 PA3142
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
GAAAACGACATCA surA,
... ... surA ostA pdxA ksgA PA0591 apaH PA0589 PA0596 PA0597 PA0598
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CAGAATGGCAGCA wbpJ,
... ... wbpJ wbpK wbpL PA3144 PA3143 PA3142
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CAGAATGCTATCG wbpJ,
... ... wbpJ wbpK wbpL PA3144 PA3143 PA3142
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CAGATCGGCATCA opr86,
... ... opr86 PA3649 PA3647 lpxD fabZ lpxA lpxB rnhB
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CGCATGGCCAGCA
... ... nadB algU mucA mucB mucC mucD lepA lepB
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CACATGGCCTTCG cobO,
... ... cobO PA1271 cobB PA1274 cobD cobC cobQ cobP cobU PA1280 cobV
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CAAGTGGCGATCA PA3825,
... ... PA3825 PA3826
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CAGCGCGCCAGCA PA3934
... ... PA3934
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CAATACGCCACCA PA3854,
... ... PA3854 PA3855 PA3853 PA3852 PA3851 PA3850
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
TACATGGCCATCG PA3670, PA3674,
... ... PA3670 PA3674 plsB PA3672 PA3671 PA3669 PA3675
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CTGCAGGCCAGCA PA3276,
... ... PA3276 PA3275
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
TGCACCGCCATCA PA0846,
... ... PA0846 PA0845
Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details RNA-Seq (ECO:0005664) - activator not specified
CCCAGGGCCAGCA PA4292
... ...