Curation Information

Publication
Genetic and physiological analysis of the major OxyR-regulated katA from Xanthomonas campestris pv. phaseoli.;Chauvatcharin N, Atichartpongkul S, Utamapongchai S, Whangsuk W, Vattanaviboon P, Mongkolsuk S;Microbiology (Reading, England) 2005 Feb; 151(Pt 2):597-605 [15699208]
TF
OxyR [M4U7P6, view regulon]
Reported TF sp.
Xanthomonas campestris pv. phaseoli
Reported site sp.
Xanthomonas campestris pv. phaseoli
Created by
Dinara Sagitova
Curation notes
-

Experimental Process

the transcriptional start site of the katA‚ÄďankA operon was mapped by primer extension analysis. Northern blot hybridization using an oxyR mutant showed that oxyR was required to mediate oxidant-dependent induction of katA expression. The direct activation of katA transcription by OxyR was shown by EMSAs. A putative OxyR binding site similar to the E.coli consensus OxyR binding motif was identified in the X. campestris pv. phaseoli katA promoter.

Transcription Factor Binding Sites


ATCAGATTCCCCTATCGAAGCGATCATAACTAACGAC
ATCATGTTCCCCTATCGAAGCGATCATAACTAACGAC

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
ATCATGTTCCCCTATCGAAGCGATCATAACTAACGAC XAC29_20300, XAC29_20305,
... ... XAC29_20300 XAC29_20305 XAC29_20295
Experimental technique details EMSA (ECO:0001807) - Experimental technique details Northern blot (ECO:0005653) - Experimental technique details Visual sequence inspection (nan) - activator not specified