engA-lacZ promoter fusion assays showed that Clp is required for transcription of the engA gene. Binding was confirmed by EMSAs. Site-directed mutagenesis with EMSA confirmed the binding specificity of Clp to its target promoter. The effect of mutations in the Clp-binding sites was tested by performing a site-directed mutagenesis in conjunction with engA-lacZ fusion assays.
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| CGATGTGATCGGTGCGGCAATG | engXCA, |
|
activator | not specified | |
| TTCTGTGGGGACGATCACACCA | engXCA, |
|
activator | not specified |