Researchers used a B-Gal assay and primer extension assay to determine that AphA represses its own promoter. They then used a DNase I assay to show that AphA protects a region within its promoter; furthermore, an EMSA of the AphA promoter showed that in-vitro binding. The site described by the authors derives from the consensus site ATATGCA-N6-TGCATAT
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| GTATTCCACTTCATGCTTAT | VP2762, |
|
repressor | dimer |