ChIP-Seq + MEME validation with ChIP-PCR Expression data curated from previous source. Details of ChIP-seq: "We compared the peak lists generated from all three samples and required that a peak be called in at least two of the three experiments to be considered a vcFur-binding site (Table S1). The average ChIP peak length was ∼500 bp."
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Site sequence | Regulated genes | Gene diagram | Experimental techniques | TF function | TF type |
|---|---|---|---|---|---|
| TTAATAATAGCAATTATCAAT | VCA0910, |
|
repressor | dimer | |
| GACATGATTTTTATTCTCATG | VCA1098, |
|
repressor | dimer |