Curation Information

Publication
Specific binding of the Xanthomonas campestris pv. vesicatoria AraC-type transcriptional activator HrpX to plant-inducible promoter boxes.;Koebnik R, Kr├╝ger A, Thieme F, Urban A, Bonas U;Journal of bacteriology 2006 Nov; 188(21):7652-60 [16936021]
TF
HrpX [Q3BW17, view regulon]
Reported TF sp.
Xanthomonas campestris pv. vesicatoria str. 85-10
Reported site sp.
Xanthomonas campestris pv. vesicatoria str. 85-10
Created by
Erill Lab
Curation notes
-

Experimental Process

Genome-wide consensus search for PIP boxes was performed. Results were then validated by RT-PCR. To determine whether HrpX binds the PIP box, we used a magnetic DNA affinity enrichment approach. A 300-bp DNA fragment harboring the two PIP boxes (14 bp from each other) of the divergently transcribed hrpB and hrpC operons was amplified by PCR. The purified DNA fragments were immobilized on streptavidin-coated magnetic beads, which were then incubated with a crude protein extract from X. campestris pv. vesicatoria containing HrpX-His. After washing and elution of bound proteins from the beads, eluted proteins were analyzed by SDS-PAGE and Western blot analysis using His tag-specific antibodies. To confirm the sequence specificity of HrpX binding, DNA fragments mutated in the PIP box were used. For this experiment, we constructed three mutants with substitutions in the hrpD PIP box.

Transcription Factor Binding Sites


TTCGCGGCGCGCGCGCCAGCTTCGT
TTCGCACACGCACCCTTGCATTCGC
TTCGCTTTGCATCGCTGCACTTCGT
TTCGGCCAAGCTTACGTCAACTCGC
TTCGTTTTTGGAGCGCCGCGTGCGG
TTCGTTTGCTGCGGCGGCGCTTCGT
TTCGCCAGCGAATTCCGATATTCGC
TTCGCCAGGCCATCCACACATTCGC
TTCGCCGGACCAGCTATCGCTTCGC
TTCGCCCATGACCATGCAGCTTCGC
TTCGCCAAAATAGTTCGTCGGCCAG
TTCGCGGCGCGCGCGCCAGCTTCGT
TTCGCACACGCACCCTTGCATTCGC
TTCGCTTTGCATCGCTGCACTTCGT
TTCGGCCAAGCTTACGTCAACTCGC
TTCGTTTTTGGAGCGCCGCGTGCGG
TTCGTTTGCTGCGGCGGCGCTTCGT
TTCGCCAGCGAATTCCGATATTCGC
TTCGCCAGGCCATCCACACATTCGC
TTCGCCGGACCAGCTATCGCTTCGC
TTCGCCCATGACCATGCAGCTTCGC
TTCGCCAAAATAGTTCGTCGGCCAG

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type
TTCGCGGCGCGCGCGCCAGCTTCGT XCV0536,
... ... XCV0536 XCV0535
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator dimer
TTCGCACACGCACCCTTGCATTCGC XCV2568,
... ... XCV2568 XCV2567 XCV2566 XCV2565
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator dimer
TTCGCTTTGCATCGCTGCACTTCGT XCV2729,
... ... XCV2729 XCV2728
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator dimer
TTCGGCCAAGCTTACGTCAACTCGC XCV3407
... ... XCV3407
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator dimer
TTCGTTTTTGGAGCGCCGCGTGCGG XCV3765,
... ... XCV3765 XCV3764
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator dimer
TTCGTTTGCTGCGGCGGCGCTTCGT XCV4424,
... ... XCV4424 XCV4425
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details qRT-PCR [RNA] (ECO:0001808) - activator dimer
TTCGCCAGCGAATTCCGATATTCGC
... ... hrcU hrcV hpaC hrcQ hrcR hrcS hpaA hrcD hrpD6 hrpE hpaB hpaE hrpB1 hrpB2 hrcJ hrpB4 hrcL hrcN hrpB7 hrcT hrcC
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA affinity purification (ECO:0005629) - activator dimer
TTCGCCAGGCCATCCACACATTCGC
... ... hrcU hrcV hpaC hrcQ hrcR hrcS hpaA hrcD hrpD6 hrpE hpaB hpaE hrpB1 hrpB2 hrcJ hrpB4 hrcL hrcN hrpB7 hrcT hrcC
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA affinity purification (ECO:0005629) - activator dimer
TTCGCCGGACCAGCTATCGCTTCGC
... ... hpaC hrcQ hrcR hrcS hpaA hrcD hrpD6 hrpE hpaB hpaE
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA affinity purification (ECO:0005629) - Experimental technique details Site directed mutagenesis (ECO:0005667) - activator dimer
TTCGCCCATGACCATGCAGCTTCGC
... ... hrcD hpaA hrpD6 hrpE hpaB hpaE
Experimental technique details Consensus search (ECO:0005624) - Experimental technique details DNA affinity purification (ECO:0005629) - activator dimer
TTCGCCAAAATAGTTCGTCGGCCAG
... ... hrpF XCV0410 hpaF hpaG XCV0407 XCV0412 XCV0413 xopF1
Experimental technique details Consensus search (ECO:0005624) - activator dimer