Curation Information

Publication
Listeria monocytogenes regulates flagellar motility gene expression through MogR, a transcriptional repressor required for virulence.;Gr√ľndling A, Burrack LS, Bouwer HG, Higgins DE;Proceedings of the National Academy of Sciences of the United States of America 2004 Aug 17; 101(33):12318-23 [15302931]
TF
MogR [P0DJO8, view regulon]
Reported TF sp.
Listeria monocytogenes EGD-e
Reported site sp.
Listeria monocytogenes EGD-e
Created by
Erill Lab
Curation notes
-

Experimental Process

Using beta-gal reporter assays on the flaA promoter with different promoter fragment sizes, a region mediating temperature-dependent repression was identified. MogR was identified as a binding protein to the flaA promoter using affinity purification with magnetic beads and SDS-PAGE. Deletion of mogR was shown to increase flaA expression with beta-gal assays.

Transcription Factor Binding Sites


AACATTTGATTTTTTAAAAAAATGAAGATATAATAAAGCATATAGAGAAGAGAAGTCTTTTCTAAACCGAATGTAGGAGGGAAACACAAA
AACATTTGATTTTTTAAAAAAATGAAGATATAATAAAGCATATAGAGAAGAGAAGTCTTTTCTAAACCGAATGTAGGAGGGAAACACAAA

Gene Regulation

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Site sequence Regulated genes Gene diagram Experimental techniques TF function TF type