Site information for: HrpX in species Xanthomonas campestris; genome accession: NC

Transcription Factor Binding Site Information

dbxref: CollecTF:EXPSITE_0002e400
Genome: Xanthomonas campestris - NC_007086.1
TF: HrpX [UniProtKB:A0A0H2X9M1, view regulon]

Supporting Evidence

Binding site	Location	Publication	Experimental techniques used	Curation
TTCGCTAGCTCGCGCAGAGTTTCGC	- [3786914, 3786938]	19810809	Experimental technique details Consensus search (ECO:0005624) Consensus search - ECO:0005624 This is a weak form of in-silico search, in which the consensus sequence for the motif is compared to genomic positions and the number of mismatches (between candidate site and consensus) is used as a measure of site-quality. - Experimental technique details GUS reporter gene assay (ECO:0005641) GUS reporter gene assay - ECO:0005641 This is a reporter assay technique, used typically to measure expression of a target gene. A promoter of interest is investigated by fusioning it with the reporter gene, which is then monitored. In GUS, the reporter is the β-glucuronidase enzyme from Escherichia coli, capable of transforming non-fluorescent substates into fluorescent, thereby allowing detection. -	1128

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

Gene	Locus tag	Description
XC_3160	XC_3160	transducer protein car