| Binding site | Location | Publication | Experimental techniques used | Curation | 
|---|---|---|---|---|
| TTCGCCCCCGGCCCCATCCATTCGC | + [1425305, 1425329] | 15225308 |  | 1121 | 
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Gene | Locus tag | Description | 
|---|---|---|
| RS_RS22570 | RS_RS22570 | hypothetical protein | 
| RS_RS22565 | RS_RS22565 | ArsR family transcriptional regulator | 
| RS_RS22560 | RS_RS22560 | ArsC family transcriptional regulator | 
| RS_RS22555 | RS_RS22555 | glycerol uptake facilitator or water-selective channels |