| Binding site | Location | Publication | Experimental techniques used | Curation | 
|---|---|---|---|---|
| TTCGTTTTGTGATGTGCCGCTTCGG | - [1627887, 1627911] | 15225308 |  | 1121 | 
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Gene | Locus tag | Description | 
|---|---|---|
| RS_RS23330 | RS_RS23330 | type III effector protein |