| Binding site | Location | Publication | Experimental techniques used | Curation | 
|---|---|---|---|---|
| TTCGCGTGCATGACCACGATTTCG | - [1107555, 1107578] | 15060033 |  | 1113 | 
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.
| Gene | Locus tag | Description | 
|---|---|---|
| RS_RS21330 | RS_RS21330 | protein PopA1 | 
| RS_RS21325 | RS_RS21325 | protein PopB | 
| RS_RS21320 | RS_RS21320 | protein PopC |