Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000296d0
Genome
Vibrio cholerae - NC_012667.1
TF
HapR [UniProtKB:A0A0H3Q915, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTATTGATATTAGTGTTTATAT + [513241, 513262] 19276207 Experimental technique details Comparative genomics search (ECO:0005622) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Luciferase reporter assay (ECO:0005648) - Experimental technique details Multiple sequence alignment (MSA) (ECO:0005556) - Experimental technique details PSSM site search (ECO:0005659) - 925

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VCD_000453 VCD_000452 VCD_000451 VCD_000450 VCD_000449
Gene Locus tag Description
VCD_000453 VCD_000453 hypothetical protein
VCD_000452 VCD_000452 hypothetical protein
VCD_000451 VCD_000451 hypothetical protein
VCD_000450 VCD_000450 non-hemolytic enterotoxin lytic component L1
VCD_000449 VCD_000449 hypothetical protein