Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000247c0
Genome
Escherichia coli - NC_000913.3
TF
ArcA [UniProtKB:P0A9Q1, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TTGTTAAGATACTGTGAAATC + [2240588, 2240608] 24146625 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details ChIP-PCR (ECO:0005620) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 871

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... mglB mglA mglC
Gene Locus tag Description
mglB b2150 methyl-galactoside transporter subunit
mglA b2149 fused methyl-galactoside transporter subunits of ABC superfamily: ATP-binding components
mglC b2148 methyl-galactoside transporter subunit