Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00023510
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CATTTTCATAACCTTTCTGTA - [230385, 230405] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SSU0226 SSU0227 SSU0228 SSU0229
Gene Locus tag Description
SSU0226 SSU0226 transcriptional regulator
SSU0227 SSU0227 membrane protein
SSU0228 SSU0228 membrane protein
SSU0229 SSU0229 ABC transporter ATP-binding protein