Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00023350
Genome
Streptococcus suis - NC_012925.1
TF
CcpA [UniProtKB:G5L2G2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
GTTTTTCTGAAATTTTCATAC + [1617876, 1617896] 24673665 Experimental technique details ChIP-Seq (ECO:0006009) - Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Motif-discovery (ECO:0005558) - 852

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... SSU1611 SSU1610
Gene Locus tag Description
SSU1611 SSU1611 aspartate kinase
SSU1610 SSU1610 haloacid dehalogenase