Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000f110
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
OxyR [UniProtKB:Q9HTL4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
ATTGATATTCCTAATCGGCGCGGTGAGGTTTTTCAAT - [5171801, 5171837] 10913087 Experimental technique details Beta-gal reporter assay - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Visual sequence inspection (nan) - 617

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... katB PA4611 PA4612 mscL
Gene Locus tag Description
katB PA4613 catalase
PA4611 PA4611 hypothetical protein
PA4612 PA4612 hypothetical protein
mscL PA4614 large-conductance mechanosensitive channel