Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_0000d050
Genome
Pseudomonas aeruginosa - NC_002516.2
TF
Vfr [UniProtKB:P55222, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AAATGTGATCTAGATCACATTT + [1557882, 1557903] 17159200 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details Motif-discovery (ECO:0005558) - 593

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... lasR
Gene Locus tag Description
lasR PA1430 transcriptional regulator LasR