Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_000078c0
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CACTGTTTATATTTTGTTTAGTA + [584937, 584959] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ompT envY pauD
Gene Locus tag Description
ompT b0565 DLP12 prophage; outer membrane protease VII (outer membrane protein 3b)
envY b0566 DNA-binding transcriptional activator of porin biosynthesis
pauD b4635 tRNA