Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00007810
Genome
Escherichia coli - NC_000913.2
TF
PhoP [UniProtKB:P23836, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
CACTATTGATGTTTGGTTAAGAT - [918349, 918371] 15703297 Experimental technique details DNA-array expression analysis (ECO:0005525) - Experimental technique details Machine learning prediction (ECO:0005649) - Experimental technique details PSSM site search (ECO:0005659) - 393

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ybjX cspD macB macA ybjD
Gene Locus tag Description
ybjX b0877 conserved protein
cspD b0880 inhibitor of DNA replication, cold shock protein homolog
macB b0879 fused macrolide transporter subunits of ABC superfamily: ATP-binding component/membrane component
macA b0878 macrolide transporter subunit, membrane fusion protein (MFP) component
ybjD b0876 conserved protein with nucleoside triphosphate hydrolase domain