Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00005080
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
AACTGATTAAAAACCCAGCG - [711238, 711257] 10760155 Experimental technique details Northern blot (ECO:0005653) - Experimental technique details PSSM site search (ECO:0005659) - 286

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ybfE ybfF
Gene Locus tag Description
ybfE b0685 LexA-regulated conserved protein
ybfF b0686 acyl-CoA esterase in vitro