Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00004790
Genome
Vibrio parahaemolyticus - NC_004603.1
TF
OpaR [UniProtKB:Q79YV4, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TATTGAGTATTATGTTAGTT + [2929630, 2929649] 22506036 Experimental technique details DNAse footprinting (ECO:0005631) - Experimental technique details EMSA (ECO:0001807) - Experimental technique details Primer Extension assay (ECO:0005657) - 207

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... VP2762 VP2761
Gene Locus tag Description
VP2762 VP2762 hypothetical protein
VP2761 VP2761 phosphoenolpyruvate carboxylase