Transcription Factor Binding Site Information

dbxref
CollecTF:EXPSITE_00001880
Genome
Escherichia coli - NC_000913.2
TF
LexA [UniProtKB:P0A7C2, view regulon]

Supporting Evidence

Binding site Location Publication Experimental techniques used Curation
TACTGGATATTTAAACAGGT - [1225561, 1225580] 16264194 Experimental technique details ChIP-chip (ECO:0006007) - Experimental technique details Motif-discovery (ECO:0005558) - Experimental technique details PSSM site search (ECO:0005659) - 69

Regulated genes

Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.

... ... ycgJ minE minD minC
Gene Locus tag Description
ycgJ b1177 predicted protein
minE b1174 cell division topological specificity factor
minD b1175 membrane ATPase of the MinC-MinD-MinE system
minC b1176 cell division inhibitor