| Binding site | Location | Publication | Experimental techniques used | Curation | 
|---|---|---|---|---|
| GGGCTGGATGAATAAACAGGGG | + [535830, 535851] | 22305460 |  | 1 | 
Regulated genes for each binding site are displayed below. Gene regulation diagrams show binding sites, positively-regulated genes, negatively-regulated genes, both positively and negatively regulated genes, genes with unspecified type of regulation. For each indvidual site, experimental techniques used to determine the site are also given.